Regulon of Zur in Microcystis aeruginosa NIES-843

Properties
Regulator type:	Transcription factor
TF locus tag:	MAE_57540
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 5.5 Sequence: CTGAGAACAATAATCATTCTTGT Locus tag: MAE_10010 Name: ompZ Funciton: Predicted zink uptake outer membrane protein
	MAE_10010	ompZ	Predicted zink uptake outer membrane protein
Position: -34 Score: 6 Sequence: GCTACAATGATAATCATTATCAT Locus tag: MAE_31590 Name: thrS2 Funciton: Threonyl-tRNA synthetase (EC 6.1.1.3) Locus tag: MAE_31600 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	MAE_31590	thrS2	Threonyl-tRNA synthetase (EC 6.1.1.3)
	MAE_31600	yciC	Putative zinc chaperone, COG0523 family
Position: -323 Score: 5.9 Sequence: ATGATAACGATTATCATTCTAGG Locus tag: MAE_22860 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) Locus tag: MAE_22850 Name: hemB2 Funciton: Porphobilinogen synthase (EC 4.2.1.24)
	MAE_22860	folE2	GTP cyclohydrolase I (EC 3.5.4.16)
	MAE_22850	hemB2	Porphobilinogen synthase (EC 4.2.1.24)
Position: -67 Score: 4.8 Sequence: TTCAGAATGATAACGATTCTCAC Locus tag: MAE_20780 Name: znuA Funciton: Zinc ABC transporter, substrate-binding pro Locus tag: MAE_20770 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein
	MAE_20780	znuA	Zinc ABC transporter, substrate-binding pro
	MAE_20770	znuB	Zinc ABC transporter, ATP-binding protein
Position: -6 Score: 5.6 Sequence: GCTAGAATGATTATCATTATCAC Locus tag: MAE_31630 Name: alr1197 Funciton: Putative metallochaperone, similar to COG0523 family Locus tag: MAE_31640 Name: alr1198 Funciton: Metallophosphoesterase, COG0622 family Locus tag: MAE_31650 Name: alr1199 Funciton: Metal-dependent phosphatase
	MAE_31630	alr1197	Putative metallochaperone, similar to COG0523 family
	MAE_31640	alr1198	Metallophosphoesterase, COG0622 family
	MAE_31650	alr1199	Metal-dependent phosphatase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD