Regulon of Zur in Cyanothece sp. PCC 7425

Properties
Regulator type:	Transcription factor
TF locus tag:	Cyan7425_4383, Cyan7425_1917
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 5.3 Sequence: ATAAGAATTATTCTCATTTTCAC Locus tag: Cyan7425_0794 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
	Cyan7425_0794	cce_1485	Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
Position: -29 Score: 5.2 Sequence: TTGAAAATGAGAATGGTTCTTAT Locus tag: Cyan7425_0822 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
	Cyan7425_0822	cce_1484	Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
Position: -41 Score: 6.2 Sequence: TTGATAATGATTATCATTGTATA Locus tag: Cyan7425_1909 Name: yciC2 Funciton: Putative zinc chaperone, COG0523 family Locus tag: Cyan7425_1908 Name: COG2319 Funciton: WD-40 repeat-containing protein, COG2319 family
	Cyan7425_1909	yciC2	Putative zinc chaperone, COG0523 family
	Cyan7425_1908	COG2319	WD-40 repeat-containing protein, COG2319 family
Position: -104 Score: 6.4 Sequence: AAGGCAATGATAATCATTATCAT Locus tag: Cyan7425_1916 Name: Cyan7425_1916 Funciton: Hypothetical protein Locus tag: Cyan7425_1915 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: Cyan7425_1914 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: Cyan7425_1913 Name: znuC Funciton: Zinc ABC transporter, permease protein
	Cyan7425_1916	Cyan7425_1916	Hypothetical protein
	Cyan7425_1915	znuA	Zinc ABC transporter, substrate-binding protein
	Cyan7425_1914	znuB	Zinc ABC transporter, ATP-binding protein
	Cyan7425_1913	znuC	Zinc ABC transporter, permease protein
Position: -56 Score: 6.4 Sequence: ATGATAATGATTATCATTGCCTT Locus tag: Cyan7425_1917 Name: zur Funciton: Zinc uptake transcription regulator, Fur family
	Cyan7425_1917	zur	Zinc uptake transcription regulator, Fur family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD