Regulon of Zur in Prochlorococcus marinus str. MIT 9313

Properties
Regulator type:	Transcription factor
TF locus tag:	PMT2208
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 6 Sequence: ATGAGAATGATTCCCATTTTTAT Locus tag: PMT2202 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Locus tag: PMT2201 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
	PMT2202	cce_1485	Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
	PMT2201	cce_1486	Predicted Mn/Zn chelate ABC transporter, permease protein
Position: -34 Score: 6 Sequence: ATAAAAATGGGAATCATTCTCAT Locus tag: PMT2203 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
	PMT2203	cce_1484	Predicted Mn/Zn chelate ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD