Regulon of Zur in Synechococcus sp. JA-3-3Ab

Properties
Regulator type:	Transcription factor
TF locus tag:	CYA_1383
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5.7 Sequence: TTATGATTGATTATCATTCTCAT Locus tag: CYA_2533 Name: sufE Funciton: Cysteine desulfuration protein Locus tag: CYA_2532 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: CYA_2531 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: CYA_2529 Name: znuC Funciton: Zinc ABC transporter, permease protein
	CYA_2533	sufE	Cysteine desulfuration protein
	CYA_2532	znuA	Zinc ABC transporter, substrate-binding protein
	CYA_2531	znuB	Zinc ABC transporter, ATP-binding protein
	CYA_2529	znuC	Zinc ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD