Regulon of Zur in Gloeobacter violaceus PCC 7421

Properties
Regulator type:	Transcription factor
TF locus tag:	glr0783
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -6 Score: 5.3 Sequence: TCTAGAATGAGAATCATTCTTGA Locus tag: glr1694 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
	glr1694	cce_1484	Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
Position: -56 Score: 5.3 Sequence: TCAAGAATGATTCTCATTCTAGA Locus tag: gll1693 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
	gll1693	cce_1486	Predicted Mn/Zn chelate ABC transporter, permease protein
Position: -40 Score: 5.6 Sequence: TTGAGAACGACTATCATTGTTAT Locus tag: glr0533 Name: glr0533 Funciton: Predicted metal transporter Locus tag: glr0534 Name: yciC2 Funciton: Putative zinc chaperone, COG0523 family Locus tag: glr0535 Name: COG2319 Funciton: WD-40 repeat-containing protein, COG2319 family
	glr0533	glr0533	Predicted metal transporter
	glr0534	yciC2	Putative zinc chaperone, COG0523 family
	glr0535	COG2319	WD-40 repeat-containing protein, COG2319 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD