Regulon of Zur in Trichodesmium erythraeum IMS101

Properties
Regulator type:	Transcription factor
TF locus tag:	Tery_1953
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	9
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -287 Score: 5.2 Sequence: ATTATAATCATATTTATTATTAA Locus tag: Tery_3358 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
	Tery_3358	cce_1484	Predicted Mn/Zn chelate ABC transporter, permease protein
Position: -37 Score: 4.8 Sequence: AGGATAATGATTATTAAAATTGA Locus tag: Tery_2490 Name: hisI2 Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
	Tery_2490	hisI2	Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
Position: -255 Score: 5.2 Sequence: ATTATGATAATAATTATTGCAAT Locus tag: Tery_4617 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: Tery_4616 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16)
	Tery_4617	yciC	Putative zinc chaperone, COG0523 family
	Tery_4616	folE2	GTP cyclohydrolase I (EC 3.5.4.16)
Position: -43 Score: 6.5 Sequence: AAAAGAATGATAATCATTCTTAA Locus tag: Tery_4613 Name: PF07992 Funciton: Predicted FAD-dependent oxidoreductase, PF07992 family
	Tery_4613	PF07992	Predicted FAD-dependent oxidoreductase, PF07992 family
Position: -49 Score: 6.9 Sequence: AAAAGAATGATAATCATTATCAT Locus tag: Tery_4951 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: Tery_4952 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: Tery_4953 Name: znuC Funciton: Zinc ABC transporter, permease protein
	Tery_4951	znuA	Zinc ABC transporter, substrate-binding protein
	Tery_4952	znuB	Zinc ABC transporter, ATP-binding protein
	Tery_4953	znuC	Zinc ABC transporter, permease protein
Position: -84 Score: 4.3 Sequence: TTTGAAACAAGTATTATTGTTTT Locus tag: Tery_4609 Name: alr1199 Funciton: Metal-dependent phosphatase
	Tery_4609	alr1199	Metal-dependent phosphatase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD