Orthologous regulated operons containing alr1199 gene

Properties
Regulog:	Zur - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Cyanobacteria

Built upon 84 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cyanothece sp. ATCC 51142
Position: -6 Score: 4.69003 Sequence: CTAACAATGATTACTGTAATTAT Locus tag: cce_1494 Name: alr1197 Funciton: Putative metallochaperone, similar to COG0523 family Locus tag: cce_1493 Name: alr1198 Funciton: Metallophosphoesterase, COG0622 family Locus tag: cce_1492 Name: alr1199 Funciton: Metal-dependent phosphatase
alr1197-alr1198-alr1199	-6	4.7	CTAACAATGATTACTGTAATTAT	cce_1494
Microcystis aeruginosa NIES-843
Position: -6 Score: 5.55075 Sequence: GCTAGAATGATTATCATTATCAC Locus tag: MAE_31630 Name: alr1197 Funciton: Putative metallochaperone, similar to COG0523 family Locus tag: MAE_31640 Name: alr1198 Funciton: Metallophosphoesterase, COG0622 family Locus tag: MAE_31650 Name: alr1199 Funciton: Metal-dependent phosphatase
alr1197-alr1198-alr1199	-6	5.6	GCTAGAATGATTATCATTATCAC	MAE_31630
Nostoc sp. PCC 7120
Position: -29 Score: 4.43984 Sequence: AACTGCATGAAAATGATTATCAT Position: -23 Score: 6.06488 Sequence: ATGAAAATGATTATCATTTAAAA Locus tag: alr1197 Name: alr1197 Funciton: Putative metallochaperone, similar to COG0523 family Locus tag: alr1198 Name: alr1198 Funciton: Metallophosphoesterase, COG0622 family Locus tag: alr1199 Name: alr1199 Funciton: Metal-dependent phosphatase
alr1197-alr1198-alr1199	-29	4.4	AACTGCATGAAAATGATTATCAT	alr1197
	-23	6.1	ATGAAAATGATTATCATTTAAAA
Trichodesmium erythraeum IMS101
Position: -84 Score: 4.30461 Sequence: TTTGAAACAAGTATTATTGTTTT Locus tag: Tery_4609 Name: alr1199 Funciton: Metal-dependent phosphatase
alr1199	-84	4.3	TTTGAAACAAGTATTATTGTTTT	Tery_4609