Regulon of Zur in Cyanothece sp. PCC 8801

Properties
Regulator type:	Transcription factor
TF locus tag:	PCC8801_4134
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	13
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 7 Sequence: ATGATAATGATAATCATTCTAAT Locus tag: PCC8801_0774 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
	PCC8801_0774	cce_1485	Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
Position: -84 Score: 4.9 Sequence: CTCATAATGATTTTCATAATTGT Locus tag: PCC8801_2484 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
	PCC8801_2484	cce_1485	Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
Position: -53 Score: 4.9 Sequence: ACAATTATGAAAATCATTATGAG Locus tag: PCC8801_2483 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
	PCC8801_2483	cce_1484	Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
Position: -40 Score: 7 Sequence: ATTAGAATGATTATCATTATCAT Locus tag: PCC8801_0773 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
	PCC8801_0773	cce_1484	Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
Position: -152 Score: 5.7 Sequence: TCTAGAATGATAATCACTCTCAT Locus tag: PCC8801_0861 Name: smtA Funciton: Predicted zinc-binding metallothionein
	PCC8801_0861	smtA	Predicted zinc-binding metallothionein
Position: -50 Score: 5.9 Sequence: TTGAGAACGATTATCATTTTAAA Locus tag: PCC8801_0864 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) Locus tag: PCC8801_0865 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	PCC8801_0864	folE2	GTP cyclohydrolase I (EC 3.5.4.16)
	PCC8801_0865	yciC	Putative zinc chaperone, COG0523 family
Position: -72 Score: 5.5 Sequence: TTGATAATGATTATCATTCCGTG Position: -32 Score: 6.7 Sequence: ATAATAATGATTATCATTTTTAA Locus tag: PCC8801_0777 Name: hemB2 Funciton: Porphobilinogen synthase (EC 4.2.1.24)
	PCC8801_0777	hemB2	Porphobilinogen synthase (EC 4.2.1.24)
Position: -76 Score: 5.4 Sequence: TTGAGAATGATTCTTATTCTTGA Position: -38 Score: 5.7 Sequence: ATGAGAGTGATTATCATTCTAGA Locus tag: PCC8801_0862 Name: yciC2 Funciton: Putative zinc chaperone, COG0523 family Locus tag: PCC8801_0863 Name: COG2319 Funciton: WD-40 repeat-containing protein, COG2319 family
	PCC8801_0862	yciC2	Putative zinc chaperone, COG0523 family
	PCC8801_0863	COG2319	WD-40 repeat-containing protein, COG2319 family
Position: -52 Score: 5.3 Sequence: GATACAATGATAATCGTTATCAG Locus tag: PCC8801_3888 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: PCC8801_3889 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: PCC8801_3890 Name: znuC Funciton: Zinc ABC transporter, permease protein
	PCC8801_3888	znuA	Zinc ABC transporter, substrate-binding protein
	PCC8801_3889	znuB	Zinc ABC transporter, ATP-binding protein
	PCC8801_3890	znuC	Zinc ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Cyanothece sp. PCC 8801

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --