Regulon of Zur in Synechocystis sp. PCC 6803

Properties
Regulator type:	Transcription factor
TF locus tag:	sll1937
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -118 Score: 6.7 Sequence: ATGATAATGATTATCATTATTTA Locus tag: sll1550 Name: ompZ Funciton: Predicted zink uptake outer membrane protein
	sll1550	ompZ	Predicted zink uptake outer membrane protein
Position: -84 Score: 5.6 Sequence: ATGATAATGATTATCGTTTATTG Locus tag: slr2043 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: slr2044 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: slr2045 Name: znuC Funciton: Zinc ABC transporter, permease protein
	slr2043	znuA	Zinc ABC transporter, substrate-binding protein
	slr2044	znuB	Zinc ABC transporter, ATP-binding protein
	slr2045	znuC	Zinc ABC transporter, permease protein
Position: -45 Score: 5.6 Sequence: CAATAAACGATAATCATTATCAT Locus tag: sll1937 Name: zur Funciton: Zinc uptake transcription regulator, Fur family
	sll1937	zur	Zinc uptake transcription regulator, Fur family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD