Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Crp regulog to Shewanella sp MR-4

Reference regulog properties
Source regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Propagated regulon:
Target genome Shewanella sp MR-4
Orthologous TF(s) Shewmr4_0618
Regulated genes 221
Built upon 2713 sites [see more]
Predicted regulatory interactions in Shewanella sp MR-4
Locus tag Position Score Sequence
Position: -210
Score: 4.1
Sequence: CTTTGTGCAGTGTATCACAAAG
Locus tag: Shewmr4_0018
Shewmr4_0018 -210 4.1 CTTTGTGCAGTGTATCACAAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadB
Ortholog function: enoyl-CoA hydratase (EC 4.2.1.17) / delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Shewanella oneidensis MR-1 SO0021 -210 4.1 CTTTGTGCAGTGTATCACAAAG
Shewanella putrefaciens CN-32 Sputcn32_0013 -210 3.7 CTCTGTGCAGTGTATCACAAAG
Shewanella sp W3-18-1 Sputw3181_0013 -210 3.7 CTCTGTGCAGTGTATCACAAAG
Shewanella sp ANA-3 Shewana3_0024 -210 4.1 CTTTGTGCAGTGTATCACAAAG
Shewanella sp MR-4 Shewmr4_0018 -210 4.1 CTTTGTGCAGTGTATCACAAAG
Shewanella sp MR-7 Shewmr7_0016 -210 4.1 CTTTGTGCAGTGTATCACAAAG
Shewanella baltica OS155 Sbal_0021 -210 3.7 CTCTGTGCAGTGTATCACAAAG
Shewanella amazonensis SB2B Sama_0032 -193 3.8 TGCTGTGCAGTGTATCACAAAG
Shewanella pealeana ATCC 700345 Spea_0018 -134 4.6 TTTTGTGATTCGTCGCACACTG
Shewanella halifaxensis HAW-EB4 Shal_0016 -134 4.4 TTTTGTGATTAGTCGCACACTG
Shewanella piezotolerans WP3 swp_0035 -127 4.4 TTATGTGATTAGTCGCACACTG
Position: -255
Score: 4.4
Sequence: CTTTGTGATACACTGCACAAAG
Locus tag: Shewmr4_0019
Shewmr4_0019 -255 4.4 CTTTGTGATACACTGCACAAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: pepQ
Ortholog function: Xaa-Pro dipeptidase PepQ (EC 3.4.13.9)
Shewanella oneidensis MR-1 SO0022 -237 4.4 CTTTGTGATACACTGCACAAAG
Shewanella putrefaciens CN-32 Sputcn32_0014 -302 4.2 CTTTGTGATACACTGCACAGAG
Shewanella sp W3-18-1 Sputw3181_0014 -302 4.2 CTTTGTGATACACTGCACAGAG
Shewanella sp ANA-3 Shewana3_0025 -255 4.4 CTTTGTGATACACTGCACAAAG
Shewanella sp MR-4 Shewmr4_0019 -255 4.4 CTTTGTGATACACTGCACAAAG
Shewanella sp MR-7 Shewmr7_0017 -255 4.4 CTTTGTGATACACTGCACAAAG
Shewanella baltica OS155 Sbal_0022 -302 4.2 CTTTGTGATACACTGCACAGAG
Shewanella amazonensis SB2B Sama_0033 -109 4 CTTTGTGATACACTGCACAGCA
Shewanella pealeana ATCC 700345 Spea_0019 -252 4.1 CAGTGTGCGACGAATCACAAAA
Shewanella halifaxensis HAW-EB4 Shal_0017 -250 4 CAGTGTGCGACTAATCACAAAA
Shewanella sediminis HAW-EB3 Ssed_0024 -48 3.8 TTTTCTGATAGATTTTACATCA
Position: -53
Score: 5
Sequence: AAATGTGACGCGGATCACTTAT
Locus tag: Shewmr4_0081
Shewmr4_0081 -53 5 AAATGTGACGCGGATCACTTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Sbal_4271
Ortholog function: membrane protein, HPP family
Shewanella putrefaciens CN-32 Sputcn32_0064 -57 4.6 AACCGTGATGCAGATCACTTAT
Shewanella sp ANA-3 Shewana3_0083 -54 4.9 AAACGTGATGCGGATCACTTAT
Shewanella sp MR-4 Shewmr4_0081 -53 5 AAATGTGACGCGGATCACTTAT
Shewanella sp MR-7 Shewmr7_0079 -53 5 AAATGTGACGCGGATCACTTAT
Shewanella baltica OS155 Sbal_4271 -57 4.6 AACTGTGATGCAGATCACTTAC
Position: -80
Score: 4.8
Sequence: AAATTTGAGCTTGATCACACTA
Locus tag: Shewmr4_0094
Shewmr4_0094 -80 4.8 AAATTTGAGCTTGATCACACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Shewana3_0095
Ortholog function: hypothetical protein
Shewanella sp ANA-3 Shewana3_0095 -80 4.8 AAATTTGAGCTTGATCACACTA
Shewanella sp MR-4 Shewmr4_0094 -80 4.8 AAATTTGAGCTTGATCACACTA
Shewanella sp MR-7 Shewmr7_0089 -80 4.8 AAATTTGAGCTTGATCACACTA
Position: -142
Score: 4.1
Sequence: TTATGTGAGCCAGCTTGTATTT
Locus tag: Shewmr4_0098
Shewmr4_0098 -142 4.1 TTATGTGAGCCAGCTTGTATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hutC
Ortholog function: histidine utilization repressor
Shewanella oneidensis MR-1 SO0096 -151 4.1 TTATGTGAGCTAGCTTGTATTT
Shewanella putrefaciens CN-32 Sputcn32_0078 -178 4.1 TTATGTGAGCTGGCTTGTATTT
Shewanella sp W3-18-1 Sputw3181_3999 -178 4.1 TTATGTGAGCTGGCTTGTATTT
Shewanella sp ANA-3 Shewana3_0099 -142 4.1 TTATGTGAGCTAGCTTGTATTT
Shewanella sp MR-4 Shewmr4_0098 -142 4.1 TTATGTGAGCCAGCTTGTATTT
Shewanella sp MR-7 Shewmr7_0093 -142 4.1 TTATGTGAGCTAGCTTGTATTT
Shewanella baltica OS155 Sbal_4253 -177 4.1 TTATGTGAGCTAGCTTGTATTT
Shewanella loihica PV-4 Shew_3758 -138 4.1 TTATGTGAGCTAGCTTGTATTT
Shewanella pealeana ATCC 700345 Spea_4170 -106 3.8 ATTTGTGAGCTAGCTTGTGTTT
Shewanella halifaxensis HAW-EB4 Shal_0072 -106 3.9 ATTTGTGAGCCCGCTTGTATTT
Shewanella piezotolerans WP3 swp_0132 -177 4.2 ATTTGTGAGCTAGCTTGTATTT
Shewanella sediminis HAW-EB3 Ssed_4448 -150 4.1 AGTTGTGATCCAACTTGTATTT
Shewanella woodyi ATCC 51908 Swoo_4839 -201 4.1 AAGTGTGATCCAACTTGTATTT
Position: -161
Score: 4.1
Sequence: TTTCGTGAGCTAGATTAGATAT
Locus tag: Shewmr4_0134
Shewmr4_0134 -161 4.1 TTTCGTGAGCTAGATTAGATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0141
Ortholog function: sensory box/GGDEF family protein
Shewanella oneidensis MR-1 SO0141 -161 4.1 TTTCGTGAGCTAGATTAGATAT
Shewanella putrefaciens CN-32 Sputcn32_0133 -174 4.2 TTTCGTGACCTAGATTAGATAT
Shewanella sp W3-18-1 Sputw3181_3939 -174 4.2 TTTCGTGACCTAGATTAGATAT
Shewanella sp ANA-3 Shewana3_0133 -163 4.1 TTTCGTGAGCTAGATTAGATAT
Shewanella sp MR-4 Shewmr4_0134 -161 4.1 TTTCGTGAGCTAGATTAGATAT
Shewanella sp MR-7 Shewmr7_0128 -161 4.1 TTTCGTGAGCTAGATTAGATAT
Shewanella baltica OS155 Sbal_4220 -160 4.2 TTTCGTGACCTAGATTAGATAT
Shewanella baltica OS155 Sbal_4221 -160 4.2 TTTCGTGACCTAGATTAGATAT
Shewanella amazonensis SB2B Sama_0142 -137 4.6 TTTTGTGATGTGGATTAGAAAT
Shewanella loihica PV-4 Shew_0041 -55 4 TTTCGTGACCTAGATTAGACTT
Shewanella piezotolerans WP3 swp_0168 -156 4 ATTCGTGACCTAGATTAGACTT
Shewanella sediminis HAW-EB3 Ssed_4373 -198 3.7 ATCATTGATAAATATAACAAAA
Shewanella woodyi ATCC 51908 Swoo_4765 -240 4 AATCGTGACTTAGATTAGACTT
Position: -149
Score: 3.8
Sequence: CTCAATGATCCAGCTCACACTT
Locus tag: Shewmr4_0152
Shewmr4_0152 -149 3.8 CTCAATGATCCAGCTCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: pckA
Ortholog function: phosphoenolpyruvate carboxykinase [ATP] (EC 4.1.1.49)
Shewanella oneidensis MR-1 SO0162 -150 3.8 CTCAATGATCCAGCTCACACTT
Shewanella putrefaciens CN-32 Sputcn32_3571 -151 4 CACCATGATCCAGTTCACACTT
Shewanella sp W3-18-1 Sputw3181_3708 -151 4 CACCATGATCCAGTTCACACTT
Shewanella sp ANA-3 Shewana3_0147 -151 3.8 CTCAATGATCCAGCTCACACTT
Shewanella sp MR-4 Shewmr4_0152 -149 3.8 CTCAATGATCCAGCTCACACTT
Shewanella sp MR-7 Shewmr7_0147 -149 3.8 CTCAATGATCCAGCTCACACTT
Shewanella amazonensis SB2B Sama_0165 -145 4.1 TTTTCAGATCCGGCTCACACAT
Shewanella loihica PV-4 Shew_3623 -128 4.6 TTTCGCGATCTTCCTCACACAT
Shewanella pealeana ATCC 700345 Spea_0140 -112 4.9 TTTTTTGATCTAGTACACATAT
Shewanella halifaxensis HAW-EB4 Shal_4178 -112 4.8 TTTTTTGATCTTGCCCACATAT
Shewanella piezotolerans WP3 swp_0182 -113 4.9 TTTTTTGATCTAGTCCACATAT
Shewanella sediminis HAW-EB3 Ssed_4362 -142 4.1 AAACACGATCTTCCTCACACAT
Shewanella woodyi ATCC 51908 Swoo_4740 -100 3.8 AATCGTGACATAGCGCAAAGAC
Position: -222
Score: 4.2
Sequence: TTTTGTGATTAGAATCTCAGCA
Locus tag: Shewmr4_0231
Shewmr4_0231 -222 4.2 TTTTGTGATTAGAATCTCAGCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ccmA
Ortholog function: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Shewanella oneidensis MR-1 SO0263 -222 4.2 TTTTGTGATTAGAATCTCAGCA
Shewanella putrefaciens CN-32 Sputcn32_3727 -213 3.9 TTTTGTGATTAGAATCTCAGCG
Shewanella sp W3-18-1 Sputw3181_0188 -213 3.9 TTTTGTGATTAGAATCTCAGCG
Shewanella sp ANA-3 Shewana3_0231 -222 4.2 TTTTGTGATTAGAATCTCAGCA
Shewanella sp MR-4 Shewmr4_0231 -222 4.2 TTTTGTGATTAGAATCTCAGCA
Shewanella sp MR-7 Shewmr7_0226 -222 3.9 TTTTGTGATTAGAATCTCAGCG
Shewanella baltica OS155 Sbal_0228 -212 4.4 TTTTGTGATTAGAATCTCAACA
Shewanella denitrificans OS217 Sden_3569 -186 4 TTTTGTGATAAGCCTCCCAGCT
Shewanella frigidimarina NCIMB 400 Sfri_0179 -213 4.2 TTTTGTGATAACAATCTCAGCT
Shewanella amazonensis SB2B Sama_0245 -207 3.8 TTTTGTGAGTTCCCTCCCAGCT
Shewanella loihica PV-4 Shew_0190 -223 4.8 TTTTGTGATTAATATCAGAATT
Shewanella pealeana ATCC 700345 Spea_0215 -212 4.1 TTTTGTGATATTAATCTCGCCA
-112 3.8 ATATTCGAACTACATCAAATTG
Shewanella halifaxensis HAW-EB4 Shal_4104 -212 3.9 TTTTGTGACATAAACCGTACTA
-112 3.8 ATATTCGAACTACATCAAATTG
Shewanella piezotolerans WP3 swp_2043 -212 5 ATTTGTGATTTAAATCGCGTTA
-112 3.8 ATATTCGAACTACATCAAATTG
Shewanella sediminis HAW-EB3 Ssed_4287 -223 4.5 TTTTGTGATTTCAATCAAAGCT
Shewanella woodyi ATCC 51908 Swoo_4659 -224 4.2 TTTTATGACTTTAATCAAAGTA
Position: -234
Score: 4
Sequence: CAATTTGATGTGGTTCCAATAA
Position: -125
Score: 4.1
Sequence: TGCTGAGATTCTAATCACAAAA
Locus tag: Shewmr4_0232
Shewmr4_0232 -234 4 CAATTTGATGTGGTTCCAATAA
-125 4.1 TGCTGAGATTCTAATCACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: scyA
Ortholog function: cytochrome c-type protein
Shewanella oneidensis MR-1 SO0264 -234 4 CAATTTGATATGGTTCCAATAA
-125 4.1 TGCTGAGATTCTAATCACAAAA
Shewanella putrefaciens CN-32 Sputcn32_3726 -229 4 CAATTTGATGTGGTTCCAATAA
-129 3.7 CGCTGAGATTCTAATCACAAAA
Shewanella sp W3-18-1 Sputw3181_0189 -229 4 CAATTTGATGTGGTTCCAATAA
-129 3.7 CGCTGAGATTCTAATCACAAAA
Shewanella sp ANA-3 Shewana3_0232 -234 4 CAATTTGATGTGGTTCCAATAA
-125 4.1 TGCTGAGATTCTAATCACAAAA
Shewanella sp MR-4 Shewmr4_0232 -234 4 CAATTTGATGTGGTTCCAATAA
-125 4.1 TGCTGAGATTCTAATCACAAAA
Shewanella sp MR-7 Shewmr7_0227 -234 4 CAATTTGATGTGGTTCCAATAA
-125 3.7 CGCTGAGATTCTAATCACAAAA
Shewanella baltica OS155 Sbal_0229 -228 3.9 CAATATGATGTGGTTCCAATAA
-128 4.5 TGTTGAGATTCTAATCACAAAA
Shewanella denitrificans OS217 Sden_3568 -131 3.8 AGCTGGGAGGCTTATCACAAAA
-109 4.1 AGGTGTGATTTTATTAACTTTA
Shewanella frigidimarina NCIMB 400 Sfri_0180 -233 3.9 CAATTTGATATGGTTCCAAAAT
-133 4.1 AGCTGAGATTGTTATCACAAAA
Shewanella amazonensis SB2B Sama_0246 -225 4 CAATTTGATGCAGTTCCAATAA
Shewanella loihica PV-4 Shew_0191 -242 3.8 CAATTTGATATGCTTCCAAAAA
-131 4.8 AATTCTGATATTAATCACAAAA
Shewanella pealeana ATCC 700345 Spea_0216 -230 4.4 CAATTTGATGTAGTTCGAATAT
-130 4 TGGCGAGATTAATATCACAAAA
Shewanella halifaxensis HAW-EB4 Shal_4103 -230 4.4 CAATTTGATGTAGTTCGAATAT
Shewanella piezotolerans WP3 swp_2044 -231 4.4 CAATTTGATGTAGTTCGAATAT
-131 4.8 TAACGCGATTTAAATCACAAAT
Shewanella sediminis HAW-EB3 Ssed_4286 -145 4.4 AGCTTTGATTGAAATCACAAAA
Shewanella woodyi ATCC 51908 Swoo_4658 -256 3.8 CAATTTGATATGCTTCCAAAAA
-144 3.9 TACTTTGATTAAAGTCATAAAA
Position: -175
Score: 4.3
Sequence: AACTGTGACAGCGCTCACCCAA
Locus tag: Shewmr4_0272
Shewmr4_0272 -175 4.3 AACTGTGACAGCGCTCACCCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: etfD
Ortholog function: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Shewanella oneidensis MR-1 SO4453 -171 4.3 ATCTGTGACAGTGCTCACCCAA
Shewanella putrefaciens CN-32 Sputcn32_0388 -171 4.2 ATCTGTGACAGTCCTCACCCAA
Shewanella sp W3-18-1 Sputw3181_0242 -171 4.2 ATCTGTGACAGTCCTCACCCAA
Shewanella sp ANA-3 Shewana3_0273 -175 4.3 ATCTGTGACAGTGCTCACCCAA
Shewanella sp MR-4 Shewmr4_0272 -175 4.3 AACTGTGACAGCGCTCACCCAA
Shewanella sp MR-7 Shewmr7_3749 -175 4.3 AACTGTGACAGCGCTCACCCAA
Shewanella baltica OS155 Sbal_0283 -170 4.4 ATCTGTGACAGTCCTCACCTAA
Shewanella denitrificans OS217 Sden_0100 -130 4.6 TTTTGTGACACAGCTCACCTCA
Shewanella frigidimarina NCIMB 400 Sfri_0081 -159 4.7 ATTTGTGACTCGACTCACGCTA
Shewanella amazonensis SB2B Sama_3523 -157 4.3 AATTGTGACGCCGCTCACTCAG
Shewanella loihica PV-4 Shew_0086 -148 4.5 TAATGTGACACCGCTCACGAAG
Shewanella pealeana ATCC 700345 Spea_4121 -181 4.1 TTTTGTGACAGTTATCACGGCA
Shewanella halifaxensis HAW-EB4 Shal_0121 -180 4.2 TTTTGTGACAGTTATCACGCCA
Shewanella piezotolerans WP3 swp_5010 -176 4.4 TTTTGTGACACTAATCACCTCA
Shewanella sediminis HAW-EB3 Ssed_4403 -150 4.8 TTTTGTGACACCCCTCACATAC
Shewanella woodyi ATCC 51908 Swoo_4794 -135 4.7 TTTTGTGACGACACTCACATTC
Position: -187
Score: 3.9
Sequence: TTGGGTGAGCGCTGTCACAGTT
Locus tag: Shewmr4_0273
Shewmr4_0273 -187 3.9 TTGGGTGAGCGCTGTCACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: moaA
Ortholog function: molybdenum cofactor biosynthesis protein MoaA
Shewanella oneidensis MR-1 SO4452 -220 3.8 TTGGGTGAGCACTGTCACAGAT
Shewanella putrefaciens CN-32 Sputcn32_0389 -187 3.8 TTGGGTGAGGACTGTCACAGAT
Shewanella sp W3-18-1 Sputw3181_0243 -187 3.8 TTGGGTGAGGACTGTCACAGAT
Shewanella sp ANA-3 Shewana3_0274 -187 3.8 TTGGGTGAGCACTGTCACAGAT
Shewanella sp MR-4 Shewmr4_0273 -187 3.9 TTGGGTGAGCGCTGTCACAGTT
Shewanella sp MR-7 Shewmr7_3748 -187 3.9 TTGGGTGAGCGCTGTCACAGTT
Shewanella baltica OS155 Sbal_0284 -187 4 TTAGGTGAGGACTGTCACAGAT
Shewanella denitrificans OS217 Sden_0101 -186 4.3 TGAGGTGAGCTGTGTCACAAAA
Shewanella frigidimarina NCIMB 400 Sfri_0082 -186 4.5 TAGCGTGAGTCGAGTCACAAAT
Shewanella amazonensis SB2B Sama_3524 -180 4 CTGAGTGAGCGGCGTCACAATT
Shewanella loihica PV-4 Shew_0087 -189 4.4 CTTCGTGAGCGGTGTCACATTA
Shewanella pealeana ATCC 700345 Spea_4120 -222 4.1 TGCCGTGATAACTGTCACAAAA
Shewanella halifaxensis HAW-EB4 Shal_0122 -222 4.3 TGGCGTGATAACTGTCACAAAA
Shewanella piezotolerans WP3 swp_5009 -222 4.3 TGAGGTGATTAGTGTCACAAAA
Shewanella sediminis HAW-EB3 Ssed_4402 -221 4.4 GTATGTGAGGGGTGTCACAAAA
Shewanella woodyi ATCC 51908 Swoo_4793 -222 4.3 GAATGTGAGTGTCGTCACAAAA
Position: -94
Score: 4
Sequence: TGATGTGAGCTTAATCCCGATT
Locus tag: Shewmr4_0298
Shewmr4_0298 -94 4 TGATGTGAGCTTAATCCCGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1415
Ortholog function: transcriptional regulator, TetR family
Shewanella oneidensis MR-1 SO1415 -135 3.8 GTATTTGAAGTAACTCACAAAG
-94 4 AGGTGTGACCTTTATCCCGATT
Shewanella sp MR-4 Shewmr4_0298 -241 3.8 ATTCGTGAGTTATCTCGTGAAT
-94 4 TGATGTGAGCTTAATCCCGATT
Shewanella loihica PV-4 Shew_0277 -137 4.4 TTGTTTGACGTAATTCACAAAG
Shewanella pealeana ATCC 700345 Spea_0326 -247 4.1 ATTCGTGAGTCAGCTCTCGAAT
-138 4.5 TTATATGACGTAATTCACAAAG
Shewanella halifaxensis HAW-EB4 Shal_3965 -247 4.2 ATTCGTGAGGCAGCTCTCGAAT
-138 4.3 TTGTATGACGTAACTCACAAAG
Shewanella sediminis HAW-EB3 Ssed_4183 -259 3.9 ATTCGTGAAGCAGATCTCGAAG
-136 4.1 TTACATGAGGTAACTCACAAAG
Position: -263
Score: 4
Sequence: AATCGGGATTAAGCTCACATCA
Position: -75
Score: 4
Sequence: AGTCGTGACTCACTTCTCCTTA
Locus tag: Shewmr4_0299
Shewmr4_0299 -263 4 AATCGGGATTAAGCTCACATCA
-75 4 AGTCGTGACTCACTTCTCCTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1414
Ortholog function: flavocytochrome c flavin subunit
Shewanella oneidensis MR-1 SO1414 -220 4.3 CTTTGTGAGTTACTTCAAATAC
Shewanella sp MR-4 Shewmr4_0299 -263 4 AATCGGGATTAAGCTCACATCA
Shewanella loihica PV-4 Shew_0276 -216 4.2 CTTTGTGAATTACGTCAAACAA
Shewanella pealeana ATCC 700345 Spea_0325 -228 4.3 CTTTGTGAATTACGTCATATAA
-181 4.1 CAGATTGATTCCTTTCACATTT
-78 4.4 TGGCGTGACTTAGTTCACCTTT
Shewanella halifaxensis HAW-EB4 Shal_3966 -269 4 AATCGGGATTCACTTCACGCTA
-228 4.2 CTTTGTGAGTTACGTCATACAA
-78 4.4 TGGCGTGACTTAGTTCACCTTT
Shewanella sediminis HAW-EB3 Ssed_4184 -280 3.8 AATCGGGATTAGCTTCACGCAA
-239 4.1 CTTTGTGAGTTACCTCATGTAA
-116 4 CTTCGAGATCTGCTTCACGAAT
Position: -108
Score: 4.4
Sequence: TGCCGTGATCCAATTCACCTTT
Position: -68
Score: 4.1
Sequence: TATTGTTAGTCACGTAACAATA
Locus tag: Shewmr4_0303
Shewmr4_0303 -108 4.4 TGCCGTGATCCAATTCACCTTT
-68 4.1 TATTGTTAGTCACGTAACAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1410
Ortholog function: conserved domain protein
Shewanella oneidensis MR-1 SO1410 -122 4.5 TGGCGTGATCCAATTCACCTTT
-82 4.1 TATTGTTAGTCACGTAACAAAA
Shewanella sp MR-4 Shewmr4_0303 -108 4.4 TGCCGTGATCCAATTCACCTTT
-68 4.1 TATTGTTAGTCACGTAACAATA
Shewanella loihica PV-4 Shew_0272 -151 3.9 ATTCGCGAGCCAAGTCACGAAT
-110 4.6 TGGCGTGATCCATTTCACCTTT
Shewanella pealeana ATCC 700345 Spea_0321 -157 4.1 ATTCGCGACCGAGCTCACGAAT
-116 4.1 CTGCGTGATCCATTTCAACTTT
Shewanella halifaxensis HAW-EB4 Shal_3970 -156 4.1 ATTCGCGACTTGGCTCACGAAT
-115 4.1 CTGCGTGATCCAATTCAACTTT
Shewanella sediminis HAW-EB3 Ssed_4188 -154 3.9 ATTCGCGAGCTCTGTCACGAAT
-113 4.2 GTGCGTGATCCAATTCACCTTT
Position: -134
Score: 3.6
Sequence: CAATGTGAGGTTTCGAATATAT
Position: -86
Score: 4.3
Sequence: TATAGTGATTTCAATCACAACC
Locus tag: Shewmr4_0361
Shewmr4_0361 -134 3.6 CAATGTGAGGTTTCGAATATAT
-86 4.3 TATAGTGATTTCAATCACAACC
Supported by regulated orthologs from reference regulons
Ortholog gene name: ilvC
Ortholog function: Ketol-acid reductoisomerase (EC 1.1.1.86)
Shewanella oneidensis MR-1 SO4349 -86 4 TATAGTGACTTCAATCACAACC
Shewanella putrefaciens CN-32 Sputcn32_3615 -86 4.3 TATAGTGATTTCAATCACAACC
Shewanella sp W3-18-1 Sputw3181_3755 -86 4.3 TATAGTGATTTCAATCACAACC
Shewanella sp ANA-3 Shewana3_0355 -86 4.3 TATAGTGATTTCAATCACAACC
Shewanella sp MR-4 Shewmr4_0361 -86 4.3 TATAGTGATTTCAATCACAACC
Shewanella sp MR-7 Shewmr7_3665 -86 4.3 TATAGTGATTTCAATCACAACC
Shewanella baltica OS155 Sbal_4032 -85 4.3 TATAGTGATTTCAATCACAACC
Shewanella frigidimarina NCIMB 400 Sfri_0421 -85 4.1 TATAGTGACTTCAATCACAACG
Shewanella amazonensis SB2B Sama_3282 -88 4.4 TATAGTGAGTTCAATCACAATC
Shewanella loihica PV-4 Shew_0288 -126 3.7 CAATGTGACGTTTCGAATATAT
-77 3.8 ATAGTTGATCTCATTCACAGCT
Shewanella piezotolerans WP3 swp_0358 -77 4.6 TATAGTGATCTCAATCACAGCT
Shewanella sediminis HAW-EB3 Ssed_4166 -78 4 TATAGTGATCTCAATCACTGCT
Shewanella woodyi ATCC 51908 Swoo_0441 -78 3.5 TATAGTGAATTCAATCACTGCT
Position: -172
Score: 4.2
Sequence: AAGTGTGCTCATGTTAACACTT
Position: -132
Score: 4.3
Sequence: AAATGAGAAGTTCGTCACACTT
Locus tag: Shewmr4_0388
Shewmr4_0388 -172 4.2 AAGTGTGCTCATGTTAACACTT
-132 4.3 AAATGAGAAGTTCGTCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hemC
Ortholog function: Porphobilinogen deaminase (EC 2.5.1.61)
Shewanella oneidensis MR-1 SO4313 -172 3.9 GATTGTGCTCATGTTAACACTT
-132 4.5 AAATGAGAGGTCCATCACACTT
Shewanella putrefaciens CN-32 Sputcn32_3587 -173 4.1 AAGTGTGCTTATGTTAACACTT
-133 5.2 AAATGAGATCTGCATCACATTT
Shewanella sp W3-18-1 Sputw3181_3726 -173 4.1 AAGTGTGCTTATGTTAACACTT
-133 5.2 AAATGAGATCTGCATCACATTT
Shewanella sp ANA-3 Shewana3_0386 -172 4.2 AAGTGTGCTCATGTTAACACTT
-132 4.3 AAATGAGAAGTTCGTCACACTT
Shewanella sp MR-4 Shewmr4_0388 -172 4.2 AAGTGTGCTCATGTTAACACTT
-132 4.3 AAATGAGAAGTTCGTCACACTT
Shewanella sp MR-7 Shewmr7_3638 -172 4.2 AAGTGTGCTCATGTTAACACTT
-132 4.3 AAATGAGAAGTTCGTCACACTT
Shewanella baltica OS155 Sbal_4000 -132 4.9 AAATGTGAAGTCCGTCACACTT
Shewanella denitrificans OS217 Sden_0388 -85 3.9 AAATCTGCTTTGCTTCAAACAT
Shewanella frigidimarina NCIMB 400 Sfri_0440 -167 4 AATGGTGATCATCGTAGCATTT
Shewanella amazonensis SB2B Sama_3254 -89 5.1 ATTTGCGATAGAGATCACATTT
Shewanella loihica PV-4 Shew_0318 -119 4.7 ATTTGAGAGCTGGATCACACTT
Shewanella pealeana ATCC 700345 Spea_0373 -133 5 AAATGCGATCAAGATCACACTT
Shewanella halifaxensis HAW-EB4 Shal_3917 -133 5.1 AAATGTGATCAACATCACGCTT
Shewanella piezotolerans WP3 swp_0402 -40 4.3 AAATGTAATCCGTATCGCAACA
Shewanella sediminis HAW-EB3 Ssed_4133 -133 4.9 AAATGAGATCAAGATCACACTT
Shewanella woodyi ATCC 51908 Swoo_0483 -229 4.6 AAATGAGACCAAGATCACACTT
Position: -92
Score: 4.7
Sequence: AAGTGTGACGAACTTCTCATTT
Position: -52
Score: 3.9
Sequence: AAGTGTTAACATGAGCACACTT
Locus tag: Shewmr4_0389
Shewmr4_0389 -92 4.7 AAGTGTGACGAACTTCTCATTT
-52 3.9 AAGTGTTAACATGAGCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cyaA
Ortholog function: Adenylate cyclase (EC 4.6.1.1)
Shewanella oneidensis MR-1 SO4312 -91 5 AAGTGTGATGGACCTCTCATTT
Shewanella putrefaciens CN-32 Sputcn32_3586 -91 5.4 AAATGTGATGCAGATCTCATTT
-51 3.8 AAGTGTTAACATAAGCACACTT
Shewanella sp W3-18-1 Sputw3181_3725 -91 5.4 AAATGTGATGCAGATCTCATTT
-51 3.8 AAGTGTTAACATAAGCACACTT
Shewanella sp ANA-3 Shewana3_0387 -92 4.7 AAGTGTGACGAACTTCTCATTT
-52 3.9 AAGTGTTAACATGAGCACACTT
Shewanella sp MR-4 Shewmr4_0389 -92 4.7 AAGTGTGACGAACTTCTCATTT
-52 3.9 AAGTGTTAACATGAGCACACTT
Shewanella sp MR-7 Shewmr7_3637 -92 4.7 AAGTGTGACGAACTTCTCATTT
-52 3.9 AAGTGTTAACATGAGCACACTT
Shewanella frigidimarina NCIMB 400 Sfri_0441 -129 3.8 AAATGCTACGATGATCACCATT
-100 3.9 AAATGTGATCTTGATTGGCAAA
Shewanella amazonensis SB2B Sama_3253 -90 5.4 AAATGTGATCTCTATCGCAAAT
Shewanella loihica PV-4 Shew_0319 -88 5.1 AAGTGTGATCCAGCTCTCAAAT
Shewanella pealeana ATCC 700345 Spea_0374 -87 5.3 AAGTGTGATCTTGATCGCATTT
Shewanella halifaxensis HAW-EB4 Shal_3916 -88 5.3 AAGCGTGATGTTGATCACATTT
Shewanella piezotolerans WP3 swp_0403 -106 5.5 AAATGTGATCGGAGTCACATTT
Shewanella sediminis HAW-EB3 Ssed_4132 -90 5.2 AAGTGTGATCTTGATCTCATTT
Shewanella woodyi ATCC 51908 Swoo_0484 -98 5 AAGTGTGATCTTGGTCTCATTT
Position: -144
Score: 4.2
Sequence: TTTTGTGATCCTCTTCTAAGAG
Locus tag: Shewmr4_0402
Shewmr4_0402 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: frdC1
Ortholog function: Fumarate reductase cytochrome b subunit
Shewanella oneidensis MR-1 SO0396 -144 4 TTTTGTGATCATCTTCTAAGAG
-79 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella putrefaciens CN-32 Sputcn32_3441 -144 4.3 TTTTGTGATCTTCTTCTAAGAG
-67 4.1 ATTTGTGAGCGATATTAACTTT
Shewanella sp W3-18-1 Sputw3181_0498 -144 4.3 TTTTGTGATCTTCTTCTAAGAG
-67 4.1 ATTTGTGAGCGATATTAACTTT
Shewanella sp ANA-3 Shewana3_0401 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
-77 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella sp MR-4 Shewmr4_0402 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
-77 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella sp MR-7 Shewmr7_3623 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
-76 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella baltica OS155 Sbal_3937 -145 4.3 TTTTGTGATCTTCTTCTAAGAG
-105 4.1 TCAATTGATCTGGCTCACGTTT
Shewanella frigidimarina NCIMB 400 Sfri_0456 -135 3.8 TTGTGTGACCCGCTTCTAACTC
-103 3.8 ATAGGTGAACATTATCACGGTT
Shewanella frigidimarina NCIMB 400 Sfri_0456 -135 3.8 TTGTGTGACCCGCTTCTAACTC
-103 3.8 ATAGGTGAACATTATCACGGTT
Shewanella amazonensis SB2B Sama_3222 -144 4.1 GTTTGTGATCCGCTTCCAATAA
Shewanella pealeana ATCC 700345 Spea_0392 -138 4.7 ATTTGTGATCTTGATCTAATAG
-106 4 AAGGGTGAGTTCCTTCACGAAA
-94 4.1 TTTGTTGATCTATCTCACGGTT
Shewanella halifaxensis HAW-EB4 Shal_3899 -138 3.9 GTTTGTGATCTACGTCTAATAG
-106 4.2 TGTAGTGACACTGATCACGAAA
-94 4.1 TTTGTTGATCTATCTCACGGTT
Shewanella piezotolerans WP3 swp_0428 -106 3.8 TAGGGTGAGCAAAGTCACGATT
-94 3.9 TTTGTTGATCTATCTCACTGTT
Shewanella sediminis HAW-EB3 Ssed_4116 -126 4.5 GTTTGTGATCTGCTTCAAATAG
Shewanella woodyi ATCC 51908 Swoo_0507 -138 4.8 GTTTGTGATGTGGTTCAAAAAA
Position: -77
Score: 3.9
Sequence: ATTTGTGAGCGATATTAATTTT
Locus tag: Shewmr4_0403
Shewmr4_0403 -77 3.9 ATTTGTGAGCGATATTAATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fdrC
Ortholog function: fumarate reductase cytochrome b subunit
Shewanella oneidensis MR-1 SO0397 -79 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella oneidensis MR-1 SO0397 -144 4 TTTTGTGATCATCTTCTAAGAG
-79 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella putrefaciens CN-32 Sputcn32_3440 -67 4.1 ATTTGTGAGCGATATTAACTTT
Shewanella putrefaciens CN-32 Sputcn32_3440 -144 4.3 TTTTGTGATCTTCTTCTAAGAG
-67 4.1 ATTTGTGAGCGATATTAACTTT
Shewanella sp W3-18-1 Sputw3181_0499 -67 4.1 ATTTGTGAGCGATATTAACTTT
Shewanella sp W3-18-1 Sputw3181_0499 -144 4.3 TTTTGTGATCTTCTTCTAAGAG
-67 4.1 ATTTGTGAGCGATATTAACTTT
Shewanella sp ANA-3 Shewana3_0402 -77 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella sp ANA-3 Shewana3_0402 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
-77 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella sp MR-4 Shewmr4_0403 -77 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella sp MR-4 Shewmr4_0403 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
-77 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella sp MR-7 Shewmr7_3622 -76 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella sp MR-7 Shewmr7_3622 -144 4.2 TTTTGTGATCCTCTTCTAAGAG
-76 3.9 ATTTGTGAGCGATATTAATTTT
Shewanella baltica OS155 Sbal_3936 -105 4.1 TCAATTGATCTGGCTCACGTTT
Shewanella baltica OS155 Sbal_3936 -145 4.3 TTTTGTGATCTTCTTCTAAGAG
-105 4.1 TCAATTGATCTGGCTCACGTTT
Shewanella amazonensis SB2B Sama_3221 -144 4.1 GTTTGTGATCCGCTTCCAATAA
Shewanella loihica PV-4 Shew_0333 -98 4.4 TGTTTTGATCTATCTCACGGTT
Shewanella loihica PV-4 Shew_0333 -98 4.4 TGTTTTGATCTATCTCACGGTT
Shewanella pealeana ATCC 700345 Spea_0393 -138 4.7 ATTTGTGATCTTGATCTAATAG
-106 4 AAGGGTGAGTTCCTTCACGAAA
-94 4.1 TTTGTTGATCTATCTCACGGTT
Shewanella pealeana ATCC 700345 Spea_0393 -94 4.1 TTTGTTGATCTATCTCACGGTT
Shewanella halifaxensis HAW-EB4 Shal_3898 -138 3.9 GTTTGTGATCTACGTCTAATAG
-106 4.2 TGTAGTGACACTGATCACGAAA
-94 4.1 TTTGTTGATCTATCTCACGGTT
Shewanella halifaxensis HAW-EB4 Shal_3898 -94 4.1 TTTGTTGATCTATCTCACGGTT
Shewanella piezotolerans WP3 swp_0429 -106 3.8 TAGGGTGAGCAAAGTCACGATT
-94 3.9 TTTGTTGATCTATCTCACTGTT
Shewanella piezotolerans WP3 swp_0429 -94 3.9 TTTGTTGATCTATCTCACTGTT
Shewanella sediminis HAW-EB3 Ssed_4115 -104 4.4 TGTTTTGATCTGCCTCACGGTT
-74 3.9 ATATGTGAGCGACATTATGATT
Shewanella sediminis HAW-EB3 Ssed_4115 -104 4.4 TGTTTTGATCTGCCTCACGGTT
-74 3.9 ATATGTGAGCGACATTATGATT
Shewanella woodyi ATCC 51908 Swoo_0508 -109 4.7 TGATTTGATCTGTCTCACAGTA
-79 4 ATTTGTGAGCGACATTATCTAA
Shewanella woodyi ATCC 51908 Swoo_0508 -109 4.7 TGATTTGATCTGTCTCACAGTA
-79 4 ATTTGTGAGCGACATTATCTAA
Position: -113
Score: 4.7
Sequence: TATTGTGATCAGTATCAAACAC
Locus tag: Shewmr4_0430
Shewmr4_0430 -113 4.7 TATTGTGATCAGTATCAAACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: lpdA
Ortholog function: Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Shewanella oneidensis MR-1 SO0426 -113 4.7 TATTGTGATCAGTATCAAACAC
Shewanella putrefaciens CN-32 Sputcn32_3415 -111 4.7 TATTGTGATCAGTATCAAACAC
Shewanella sp W3-18-1 Sputw3181_0528 -111 4.7 TATTGTGATCAGTATCAAACAC
Shewanella sp ANA-3 Shewana3_0428 -113 4.7 TATTGTGATCAGTATCAAACAC
Shewanella sp MR-4 Shewmr4_0430 -113 4.7 TATTGTGATCAGTATCAAACAC
Shewanella sp MR-7 Shewmr7_3597 -113 4.7 TATTGTGATCAGTATCAAACAC
Shewanella baltica OS155 Sbal_3911 -111 4.7 TATTGTGATCAGTATCAAACAC
Shewanella frigidimarina NCIMB 400 Sfri_3775 -168 5.1 TATTGTGATCGGTTTCAAACAA
Shewanella pealeana ATCC 700345 Spea_0421 -128 4.5 GATTGTGATCAGCATCAAACAA
Shewanella halifaxensis HAW-EB4 Shal_0478 -130 4.6 GATTGTGATCCGTATCAAACAA
Shewanella piezotolerans WP3 swp_4749 -113 4.5 GATTGTGATCAGTATCAAACAA
Position: -315
Score: 3.9
Sequence: AAGTATGAATCAGGTCACACTC
Locus tag: Shewmr4_0436
Shewmr4_0436 -315 3.9 AAGTATGAATCAGGTCACACTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yniC
Ortholog function: 2-deoxyglucose-6-phosphate hydrolase YniC
Shewanella oneidensis MR-1 SO0431 -302 3.9 AAGTATGAATCAGGTCACACTC
-118 3.8 TAACGAAATGCTTTTCACAGTA
Shewanella putrefaciens CN-32 Sputcn32_3410 -316 3.9 AAGTATGAATCAGGTCACACTC
Shewanella sp W3-18-1 Sputw3181_0533 -316 3.9 AAGTATGAATCAGGTCACACTC
Shewanella sp ANA-3 Shewana3_0432 -315 3.9 AAGTATGAATCAGGTCACACTC
Shewanella sp MR-4 Shewmr4_0436 -315 3.9 AAGTATGAATCAGGTCACACTC
Shewanella sp MR-7 Shewmr7_3593 -315 3.9 AAGTATGAATCAGGTCACACTC
Shewanella baltica OS155 Sbal_3906 -315 3.9 AAGTATGAATCAGGTCACACTC
Shewanella denitrificans OS217 Sden_3378 -316 4 AAGTATGAATCGGCTCACACTG
Shewanella frigidimarina NCIMB 400 Sfri_3772 -288 4.3 AAGTATGAATCAGCTCACACTA
Shewanella amazonensis SB2B Sama_0381 -255 4 AAGTATGAATCAGCTCACACTC
Shewanella loihica PV-4 Shew_3425 -295 4.1 AAGTATGAATCAGATCACACTC
Shewanella pealeana ATCC 700345 Spea_0424 -286 4.3 AAGTATGAATCCGATCACACTT
-178 4.1 AAACTTGATCTAAATTATATAA
Shewanella halifaxensis HAW-EB4 Shal_0481 -286 4.5 AAGTATGAATCCGATCACATTT
-178 3.7 AACCTTGATCTAAATTATATAA
Shewanella piezotolerans WP3 swp_4741 -283 4.4 AAGTATGAATCAGATCACACTT
-177 3.7 AACACTGAGATTAATCACATAA
-101 3.7 TTTCGTAAAGCTAAACACAATA
Shewanella sediminis HAW-EB3 Ssed_0437 -296 4.2 AAGTTTGAATCAGATCACACTC
Shewanella woodyi ATCC 51908 Swoo_0284 -296 4.2 AAGTTTGAATCAGATCACACTC
Position: -66
Score: 4.1
Sequence: GAGTGTGACCTGATTCATACTT
Locus tag: Shewmr4_0437
Shewmr4_0437 -66 4.1 GAGTGTGACCTGATTCATACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: acnB
Ortholog function: aconitate hydratase 2 (EC 4.2.1.3) @ 2-methylisocitrate dehydratase (EC 4.2.1.99)
Shewanella oneidensis MR-1 SO0432 -141 4.1 GAGTGTGACCTGATTCATACTT
Shewanella putrefaciens CN-32 Sputcn32_3409 -141 4.1 GAGTGTGACCTGATTCATACTT
Shewanella sp W3-18-1 Sputw3181_0534 -141 4.1 GAGTGTGACCTGATTCATACTT
Shewanella sp ANA-3 Shewana3_0433 -66 4.1 GAGTGTGACCTGATTCATACTT
Shewanella sp MR-4 Shewmr4_0437 -66 4.1 GAGTGTGACCTGATTCATACTT
Shewanella sp MR-7 Shewmr7_3592 -66 4.1 GAGTGTGACCTGATTCATACTT
Shewanella baltica OS155 Sbal_3905 -66 4.1 GAGTGTGACCTGATTCATACTT
Shewanella denitrificans OS217 Sden_3377 -139 4.1 CAGTGTGAGCCGATTCATACTT
-67 3.9 AATTGTTAGCCTTATCACTATG
Shewanella frigidimarina NCIMB 400 Sfri_3771 -139 4.6 TAGTGTGAGCTGATTCATACTT
Shewanella amazonensis SB2B Sama_0382 -138 4 GAGTGTGAGCTGATTCATACTT
Shewanella loihica PV-4 Shew_3424 -140 4.3 GAGTGTGATCTGATTCATACTT
Shewanella pealeana ATCC 700345 Spea_0425 -268 4 TTATATAATTTAGATCAAGTTT
-160 4.8 AAGTGTGATCGGATTCATACTT
Shewanella halifaxensis HAW-EB4 Shal_0482 -247 3.7 TTATATAATTTAGATCAAGGTT
-139 5 AAATGTGATCGGATTCATACTT
Shewanella piezotolerans WP3 swp_4740 -245 3.9 TTATGTGATTAATCTCAGTGTT
-139 4.9 AAGTGTGATCTGATTCATACTT
Shewanella sediminis HAW-EB3 Ssed_0438 -141 4.4 GAGTGTGATCTGATTCAAACTT
Shewanella woodyi ATCC 51908 Swoo_0285 -139 4.4 GAGTGTGATCTGATTCAAACTT
Position: -77
Score: 3.8
Sequence: AAGCGTGAACTTAAGCACACTC
Locus tag: Shewmr4_0442
Shewmr4_0442 -77 3.8 AAGCGTGAACTTAAGCACACTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0439
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO0439 -34 4.4 ATACGTGATCTGACGCACATCA
Shewanella putrefaciens CN-32 Sputcn32_3403 -90 4.5 AAATGTGAACCAGAGCACACTC
Shewanella sp W3-18-1 Sputw3181_0540 -90 4.5 AAATGTGAACCAGAGCACACTC
Shewanella sp ANA-3 Shewana3_0438 -78 4.2 AAGCGTGAGCTAACGCACACAA
Shewanella sp MR-4 Shewmr4_0442 -77 3.8 AAGCGTGAACTTAAGCACACTC
Shewanella sp MR-7 Shewmr7_3587 -77 3.8 AAGCGTGAACTTAAGCACACTC
Shewanella baltica OS155 Sbal_0417 -93 4.8 AAATGTGACCTAAAGCACATAC
Shewanella frigidimarina NCIMB 400 Sfri_0491 -135 5.2 TTTTATGATTTAGATCACAAAA
Shewanella pealeana ATCC 700345 Spea_0430 -137 4.8 TTTTGTGATCTAAGTAGCAAAA
Shewanella halifaxensis HAW-EB4 Shal_0486 -138 4.7 TTTTGTGACATAGGTAACACAA
Shewanella sediminis HAW-EB3 Ssed_3193 -105 4.3 ATTTGTGACCAAGTTCCCAAAC
Shewanella woodyi ATCC 51908 Swoo_0294 -78 3.9 AAACAGGACGTAGATCACACTT
Position: -181
Score: 4.1
Sequence: TATTGTGAAATCGCGCAGAAAA
Locus tag: Shewmr4_0445
Shewmr4_0445 -181 4.1 TATTGTGAAATCGCGCAGAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: purH
Ortholog function: IMP cyclohydrolase (EC 3.5.4.10) / Phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3)
Shewanella oneidensis MR-1 SO0442 -180 4.1 TATTGTGAAATCGCGCAGAAAA
Shewanella putrefaciens CN-32 Sputcn32_3401 -193 4 TATTGTGAAATCACGCAGAAAA
Shewanella sp W3-18-1 Sputw3181_0542 -193 4 TATTGTGAAATCACGCAGAAAA
Shewanella sp ANA-3 Shewana3_0441 -181 4.1 TATTGTGAAATCGCGCAGAAAA
Shewanella sp MR-4 Shewmr4_0445 -181 4.1 TATTGTGAAATCGCGCAGAAAA
Shewanella sp MR-7 Shewmr7_3584 -181 4.1 TATTGTGAAATCGCGCAGAAAA
Shewanella baltica OS155 Sbal_0420 -195 4 TATTGTGAAATCACGCAGAAAA
Shewanella frigidimarina NCIMB 400 Sfri_0493 -195 3.9 TATTGTGAAATCACACAGAAAA
Shewanella amazonensis SB2B Sama_0395 -194 4 TATTGTGAAATCACGCAGAAAA
Shewanella loihica PV-4 Shew_3412 -182 4 TATTGTGAAATCGCACAGAAAA
Shewanella pealeana ATCC 700345 Spea_0432 -181 4.1 TATTGTGAAATCGCGCAGAAAA
Shewanella halifaxensis HAW-EB4 Shal_0488 -182 4.1 TATTGTGAAATCGCGCAGAAAA
Shewanella piezotolerans WP3 swp_4724 -181 4.1 TATTGTGAAATCGCGCAGAAAA
Shewanella sediminis HAW-EB3 Ssed_0444 -282 4 GAGTGTGACGCTCTGCACAAAT
-191 4.2 TATTGTGAAATCGTGCAGAAAA
Shewanella woodyi ATCC 51908 Swoo_0296 -192 3.6 TATTGTGAAATCACATATAAAT
Position: -159
Score: 4.3
Sequence: TTTTATGATATTTTTCATATTG
Locus tag: Shewmr4_0481
Shewmr4_0481 -159 4.3 TTTTATGATATTTTTCATATTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO4003
Ortholog function: response regulator
Shewanella oneidensis MR-1 SO4003 -165 3.7 TAAGGTGAGACTGCGCAAAATA
Shewanella sp ANA-3 Shewana3_0479 -159 4.1 TTTTATGATGATTTTCATATTG
Shewanella sp MR-4 Shewmr4_0481 -159 4.3 TTTTATGATATTTTTCATATTG
Shewanella sp MR-7 Shewmr7_3549 -159 4.2 TTTTATGATACTTTTCATATTG
Position: -328
Score: 3.8
Sequence: GAATGTGATCTGTCTCGGCATT
Position: -133
Score: 4.4
Sequence: TAATGTGCTCTAGCTCAGGTTT
Locus tag: Shewmr4_0488
Shewmr4_0488 -328 3.8 GAATGTGATCTGTCTCGGCATT
-133 4.4 TAATGTGCTCTAGCTCAGGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mccA
Ortholog function: cytochrome c, putative
Shewanella putrefaciens CN-32 Sputcn32_3364 -328 4.3 TAATGTGATCTTATTCGTTATT
-132 4.3 TAATGTGCTCTAGCTCTGATTT
Shewanella sp W3-18-1 Sputw3181_0577 -328 4.3 TAATGTGATCTTATTCGTTATT
-132 4.3 TAATGTGCTCTAGCTCTGATTT
Shewanella sp ANA-3 Shewana3_0489 -328 3.8 GAATGTGATCTGTCTCGGCATT
Shewanella sp MR-4 Shewmr4_0488 -328 3.8 GAATGTGATCTGTCTCGGCATT
-133 4.4 TAATGTGCTCTAGCTCAGGTTT
Shewanella sp MR-7 Shewmr7_3542 -328 3.8 GAATGTGATCTGTCTCGGCATT
-133 4.4 TAATGTGCTCTAGCTCAGGTTT
Position: -192
Score: 4
Sequence: AGTTATGCGCTTAATCACAAAA
Locus tag: Shewmr4_0542
Shewmr4_0542 -192 4 AGTTATGCGCTTAATCACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0543
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO0543 -192 3.7 CGTTATGCGCTAAATCACAAAA
Shewanella putrefaciens CN-32 Sputcn32_3331 -88 4.2 ATTTTTACTCTAATTCACAAAA
Shewanella sp W3-18-1 Sputw3181_0610 -88 4.2 ATTTTTACTCTAATTCACAAAA
Shewanella sp ANA-3 Shewana3_0541 -193 4.1 AGTTATGCGCTAAATCACAAAA
Shewanella sp MR-4 Shewmr4_0542 -192 4 AGTTATGCGCTTAATCACAAAA
Shewanella sp MR-7 Shewmr7_3488 -191 4 AGTTATGCGCTTAATCACAAAA
Shewanella baltica OS155 Sbal_0501 -201 4.8 TGTTGTGCTCTCAATCACAAAA
-88 3.9 AATTTTACCCTGATTCACAAAA
Shewanella denitrificans OS217 Sden_0657 -34 3.9 TAATATGACTAGAGTCAAACAT
Shewanella frigidimarina NCIMB 400 Sfri_3534 -200 4 ATATTTGATCACAAGCACACTC
Shewanella amazonensis SB2B Sama_3164 -240 3.9 CATTGTTACTCACTTCATACAT
-126 3.9 ATTTATGACCATACTCACAGAG
Shewanella loihica PV-4 Shew_0428 -190 4.2 TAGTGTTAACTCGATCAAACAA
Shewanella pealeana ATCC 700345 Spea_3733 -197 4.2 TTTTGCTACATAGATCGCATAT
Shewanella halifaxensis HAW-EB4 Shal_3818 -235 4.7 TTTTGTTACATGGATCGCATAT
Shewanella piezotolerans WP3 swp_0532 -156 4.6 TTTTGTTACACAGATCGCATAT
Shewanella sediminis HAW-EB3 Ssed_0598 -213 4.2 TAATGTTAAATCGATCTCACTT
Shewanella woodyi ATCC 51908 Swoo_4355 -215 3.8 AATTGCTAGATAGATCTCACTT
Position: -146
Score: 4.1
Sequence: TTTTGTGATTAAGCGCATAACT
Locus tag: Shewmr4_0543
Shewmr4_0543 -146 4.1 TTTTGTGATTAAGCGCATAACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0544
Ortholog function: sensory box histidine kinase
Shewanella oneidensis MR-1 SO0544 -141 4 TTTTGTGATTTAGCGCATAACG
Shewanella putrefaciens CN-32 Sputcn32_3330 -242 4 TTTTGTGAATTAGAGTAAAAAT
Shewanella sp W3-18-1 Sputw3181_0611 -242 4 TTTTGTGAATTAGAGTAAAAAT
Shewanella sp ANA-3 Shewana3_0542 -144 4.3 TTTTGTGATTTAGCGCATAACT
Shewanella sp MR-4 Shewmr4_0543 -146 4.1 TTTTGTGATTAAGCGCATAACT
Shewanella sp MR-7 Shewmr7_3487 -145 4.1 TTTTGTGATTAAGCGCATAACT
Position: -102
Score: 4.5
Sequence: TATTTTGACGCATGTCAAAATT
Locus tag: Shewmr4_0573
Shewmr4_0573 -102 4.5 TATTTTGACGCATGTCAAAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0572
Ortholog function: enoyl-CoA hydratase (EC 4.2.1.17)
Shewanella oneidensis MR-1 SO0572 -102 4.4 TATTTTGACTCAAGTCAAAATT
Shewanella putrefaciens CN-32 Sputcn32_3304 -102 4.3 TATTTTGACTAAGGTCAAAATT
Shewanella sp W3-18-1 Sputw3181_0637 -102 4.3 TATTTTGACTAAGGTCAAAATT
Shewanella sp ANA-3 Shewana3_0572 -102 4.4 TATTTTGACTCATGTCAAAAAT
Shewanella sp MR-4 Shewmr4_0573 -102 4.5 TATTTTGACGCATGTCAAAATT
Shewanella sp MR-7 Shewmr7_3457 -102 4.5 TATTTTGACGCATGTCAAAATT
Shewanella baltica OS155 Sbal_0533 -102 4.3 TATTTTGACTCAAGTCAAAAAA
Shewanella denitrificans OS217 Sden_0534 -100 3.7 ATTTTTGACTAGGGTCAATATT
Shewanella frigidimarina NCIMB 400 Sfri_3510 -237 4.2 CATTGTGATCAATGTCATATCA
Shewanella loihica PV-4 Shew_0454 -124 4.3 TATTTTGACGCCAGTCAAAAAA
Shewanella pealeana ATCC 700345 Spea_3709 -110 3.7 AAAAATGACCAATGTCATAATT
Shewanella halifaxensis HAW-EB4 Shal_3794 -110 3.9 TAAAATGATGAGTGTCATAATT
Shewanella piezotolerans WP3 swp_0563 -110 3.6 TTTATTGACGATAGTCAAAAAA
Shewanella sediminis HAW-EB3 Ssed_0623 -108 4.1 TTTTTTGACTGAAGTCAAACTT
Position: -113
Score: 4.1
Sequence: AAATGTGCGATGAGTAACAAAA
Locus tag: Shewmr4_0582
Shewmr4_0582 -113 4.1 AAATGTGCGATGAGTAACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: bfd
Ortholog function: bacterioferritin-associated ferredoxin
Shewanella putrefaciens CN-32 Sputcn32_3295 -125 4 AAATGTGCGCAGAGTAACAAAT
Shewanella sp W3-18-1 Sputw3181_0646 -125 4 AAATGTGCGCAGAGTAACAAAT
Shewanella sp ANA-3 Shewana3_0581 -113 4.1 AAATGTGCGATGAGTAACAAAA
Shewanella sp MR-4 Shewmr4_0582 -113 4.1 AAATGTGCGATGAGTAACAAAA
Shewanella sp MR-7 Shewmr7_3448 -113 4.1 AAATGTGCGATGAGTAACAAAA
Shewanella baltica OS155 Sbal_0542 -113 3.9 AAACGTGCGCCATGTAACAAAA
Shewanella frigidimarina NCIMB 400 Sfri_3324 -275 3.9 TAATCTGATCCGGCTAACACCT
-253 3.8 AATATTAACCGCTTTCACAAAT
Shewanella amazonensis SB2B Sama_3040 -99 4.1 AAGTGAGAAATAGCTCACCTAT
Shewanella pealeana ATCC 700345 Spea_3555 -98 3.9 TTAGGCGATCCGACTAACAATT
Position: -156
Score: 4.4
Sequence: TTTTGTTACTCATCGCACATTT
Locus tag: Shewmr4_0583
Shewmr4_0583 -156 4.4 TTTTGTTACTCATCGCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0584
Ortholog function: methyl-accepting chemotaxis protein
Shewanella putrefaciens CN-32 Sputcn32_3294 -147 4.3 ATTTGTTACTCTGCGCACATTT
Shewanella sp W3-18-1 Sputw3181_0647 -147 4.3 ATTTGTTACTCTGCGCACATTT
Shewanella sp ANA-3 Shewana3_0582 -157 4.4 TTTTGTTACTCATCGCACATTT
Shewanella sp MR-4 Shewmr4_0583 -156 4.4 TTTTGTTACTCATCGCACATTT
Shewanella sp MR-7 Shewmr7_3447 -156 4.4 TTTTGTTACTCATCGCACATTT
Shewanella baltica OS155 Sbal_0543 -170 4.2 TTTTGTTACATGGCGCACGTTT
Position: -132
Score: 3.7
Sequence: CACTATGATCTGCTTCTAATTT
Position: -103
Score: 3.7
Sequence: TAATGAGCCCCGCTTCAAACTT
Locus tag: Shewmr4_0602
Shewmr4_0602 -132 3.7 CACTATGATCTGCTTCTAATTT
-103 3.7 TAATGAGCCCCGCTTCAAACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: petA
Ortholog function: ubiquinol-cytochrome C reductase iron-sulfur subunit (EC 1.10.2.2)
Shewanella oneidensis MR-1 SO0608 -132 3.7 CACTATGATCTGCTTCTAATTT
-103 3.7 TAATGAGCCCCGCTTCAAACTT
Shewanella putrefaciens CN-32 Sputcn32_3276 -130 3.7 CACTATGATCTGCTTCTAATTT
-101 3.7 TAATGAGCCCCGCTTCAAACTT
Shewanella sp W3-18-1 Sputw3181_0665 -130 3.7 CACTATGATCTGCTTCTAATTT
-101 3.7 TAATGAGCCCCGCTTCAAACTT
Shewanella sp ANA-3 Shewana3_0601 -132 3.7 CACTATGATCTGCTTCTAATTT
-103 3.7 TAATGAGCCCCGCTTCAAACTT
Shewanella sp MR-4 Shewmr4_0602 -132 3.7 CACTATGATCTGCTTCTAATTT
-103 3.7 TAATGAGCCCCGCTTCAAACTT
Shewanella sp MR-7 Shewmr7_3428 -132 3.7 CACTATGATCTGCTTCTAATTT
-103 3.7 TAATGAGCCCCGCTTCAAACTT
Shewanella baltica OS155 Sbal_0562 -131 3.7 CACTATGATCTGCTTCTAATTT
-102 3.7 TAATGAGCCCCGCTTCAAACTT
Shewanella frigidimarina NCIMB 400 Sfri_3307 -129 3.8 CACTATGATCTGGTTCTAATTT
Shewanella loihica PV-4 Shew_0570 -130 4.1 TACTATGATCTGCTTCTAATTT
-101 3.9 TAATGAGCCCCGCCTCAAATTT
Shewanella pealeana ATCC 700345 Spea_3536 -78 4.2 AACTATGATCTGGTTCTAATTT
Shewanella halifaxensis HAW-EB4 Shal_3630 -128 4.6 AACTATGATCTGGCTCAAATTT
Shewanella piezotolerans WP3 swp_0793 -131 4.2 AACTATGATCTGGTTCTAATTT
Shewanella sediminis HAW-EB3 Ssed_0801 -132 4.4 TACTATGATCAAGCTCAAATTT
Shewanella woodyi ATCC 51908 Swoo_4166 -129 3.8 TACTATGATCTGCTTCTGATTT
Position: -308
Score: 3.8
Sequence: AATTGTGTAGTTATTCATATTC
Position: -142
Score: 4
Sequence: AACTGGTATTTTGATCACAATT
Locus tag: Shewmr4_0611
Shewmr4_0611 -308 3.8 AATTGTGTAGTTATTCATATTC
-142 4 AACTGGTATTTTGATCACAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: astC
Ortholog function: Acetylornithine aminotransferase (EC 2.6.1.11) / N-succinyl-L,L-diaminopimelate aminotransferase (EC 2.6.1.17) / Succinylornithine transaminase (EC 2.6.1.81)
Shewanella oneidensis MR-1 SO0617 -142 4 AACTGGTATTTTGATCACAATT
Shewanella putrefaciens CN-32 Sputcn32_0645 -142 4.1 AACTGGTATTTTGATCACATTT
Shewanella sp W3-18-1 Sputw3181_3529 -142 4.1 AACTGGTATTTTGATCACATTT
Shewanella sp ANA-3 Shewana3_0610 -142 4 AACTGGTATTTTGATCACAATT
Shewanella sp MR-4 Shewmr4_0611 -142 4 AACTGGTATTTTGATCACAATT
Shewanella sp MR-7 Shewmr7_3419 -308 3.8 AATTGTGTAGTTATTCATATTC
Shewanella baltica OS155 Sbal_0571 -142 4.1 AACTGGTATTTTGATCACATTT
Shewanella denitrificans OS217 Sden_3193 -136 4.1 AACTGGTATTTTGATCACATTT
Shewanella frigidimarina NCIMB 400 Sfri_3299 -137 4.1 AACTGGTATTTTGATCACATTT
Shewanella amazonensis SB2B Sama_3011 -142 4 AACTGGTATTTCGATCACAATT
Shewanella loihica PV-4 Shew_0578 -140 3.8 AACTGGTATTTTGATCACGTTT
Shewanella pealeana ATCC 700345 Spea_3516 -138 4.1 AACTGGTATTTTGATCACATTT
Shewanella halifaxensis HAW-EB4 Shal_3610 -138 3.7 AACTGGCATTCTGATCACATTT
Shewanella piezotolerans WP3 swp_0747 -140 4.1 AACTGGTATTTTGATCACATTT
Shewanella sediminis HAW-EB3 Ssed_0809 -141 4.1 AACTGGTATTTTGATCACATTT
-121 3.9 TTTCGTTATTAATGTCACTTAA
Shewanella woodyi ATCC 51908 Swoo_0655 -172 4.3 ATATGTGCTGCTGATCTTATTT
Position: -267
Score: 3.7
Sequence: TGAGGTTATTTTCTTCGCAAAA
Position: -226
Score: 3.5
Sequence: AGATGTGATTAACTCTACAGAG
Position: -174
Score: 3.5
Sequence: TTAGTTGACTAATATCACTAAA
Locus tag: Shewmr4_0618
Shewmr4_0618 -267 3.7 TGAGGTTATTTTCTTCGCAAAA
-226 3.5 AGATGTGATTAACTCTACAGAG
-174 3.5 TTAGTTGACTAATATCACTAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: crp
Ortholog function: Cyclic AMP receptor protein Crp
Shewanella oneidensis MR-1 SO0624 -174 3.5 TTAGTTGACTAATATCACTAAA
Shewanella putrefaciens CN-32 Sputcn32_0652 -174 3.5 TTAGTTGACTAATATCACTAAA
Shewanella sp W3-18-1 Sputw3181_3522 -174 3.5 TTAGTTGACTAATATCACTAAA
Shewanella sp ANA-3 Shewana3_0617 -174 3.5 TTAGTTGACTAATATCACTAAA
Shewanella sp MR-4 Shewmr4_0618 -174 3.5 TTAGTTGACTAATATCACTAAA
Shewanella sp MR-7 Shewmr7_3412 -174 3.5 TTAGTTGACTAATATCACTAAA
Shewanella baltica OS155 Sbal_0578 -174 3.7 TTAGTTGACTTAAATCACTAAA
Shewanella denitrificans OS217 Sden_3190 -94 3.6 AAACACGATCTTGGTCAAAGTT
Shewanella frigidimarina NCIMB 400 Sfri_3292 -97 4 AAATACGATCTCTATCAAAGTT
Shewanella amazonensis SB2B Sama_3004 -96 3.8 AATTTCGATCTGCATCATGGTT
Shewanella loihica PV-4 Shew_0585 -238 4 AGATGTGATATGGGCAACATTG
Shewanella pealeana ATCC 700345 Spea_3509 -225 3.6 AGATGTGATATAAGCCTAATTG
Shewanella halifaxensis HAW-EB4 Shal_3603 -226 3.5 AGATGTGATACAAGCCTAATTG
Shewanella piezotolerans WP3 swp_0755 -309 4.2 TTTATTGATAAGGTTCAAAAAA
Shewanella sediminis HAW-EB3 Ssed_3873 -173 3.8 TTAGTTGACTTATATCACTAAT
Shewanella woodyi ATCC 51908 Swoo_0662 -173 3.8 TTAGTTGACTTATATCACTAAT
Position: -270
Score: 4.2
Sequence: TTTAGTGATATTAGTCAACTAA
Locus tag: Shewmr4_0619
Shewmr4_0619 -270 4.2 TTTAGTGATATTAGTCAACTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sel1
Ortholog function: Sel1 domain protein repeat-containing protein precursor
Shewanella oneidensis MR-1 SO0625 -267 4.2 TTTAGTGATATTAGTCAACTAA
Shewanella putrefaciens CN-32 Sputcn32_0653 -270 4.2 TTTAGTGATATTAGTCAACTAA
Shewanella sp W3-18-1 Sputw3181_3521 -270 4.2 TTTAGTGATATTAGTCAACTAA
Shewanella sp ANA-3 Shewana3_0618 -270 4.2 TTTAGTGATATTAGTCAACTAA
Shewanella sp MR-4 Shewmr4_0619 -270 4.2 TTTAGTGATATTAGTCAACTAA
Shewanella sp MR-7 Shewmr7_3411 -270 4.2 TTTAGTGATATTAGTCAACTAA
Shewanella baltica OS155 Sbal_0579 -278 4.4 TTTAGTGATTTAAGTCAACTAA
Shewanella frigidimarina NCIMB 400 Sfri_3291 -222 4.1 AACTTTGATAGAGATCGTATTT
-147 4.3 ATTTGTGATGACGGTCGACTTT
-38 4 TTATTTAATCAGCTTCATAAAT
Shewanella amazonensis SB2B Sama_3003 -319 3.8 AACCATGATGCAGATCGAAATT
Shewanella loihica PV-4 Shew_0586 -279 3.8 ATTAGTAATATATGTCAACTAA
Shewanella piezotolerans WP3 swp_0756 -153 3.8 TTTTTTGAACCTTATCAATAAA
Shewanella sediminis HAW-EB3 Ssed_3872 -296 4.3 ATTAGTGATATAAGTCAACTAA
Shewanella woodyi ATCC 51908 Swoo_0663 -298 4.3 ATTAGTGATATAAGTCAACTAA
Position: -83
Score: 4.1
Sequence: TCTTGTGACCTAGTTCACGCCT
Locus tag: Shewmr4_0652
Shewmr4_0652 -83 4.1 TCTTGTGACCTAGTTCACGCCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3987
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO3987 -83 3.9 TCTTGTGAGCGAGTTCACGCCT
Shewanella putrefaciens CN-32 Sputcn32_0679 -83 4 TCTTGTGAGCCAGTTCACGCCT
Shewanella sp W3-18-1 Sputw3181_3492 -83 4 TCTTGTGAGCCAGTTCACGCCT
Shewanella sp ANA-3 Shewana3_0651 -83 4 TCTTGTGAGCCAGTTCACGCCT
Shewanella sp MR-4 Shewmr4_0652 -83 4.1 TCTTGTGACCTAGTTCACGCCT
Shewanella sp MR-7 Shewmr7_3370 -83 4.1 TCTTGTGACCTAGTTCACGCCT
Shewanella baltica OS155 Sbal_0787 -277 3.7 TAAAGCGATATATGTAACAAAC
Shewanella amazonensis SB2B Sama_0602 -307 4.1 AAATTGAATATGGATCACATTT
Shewanella loihica PV-4 Shew_0778 -147 5.1 AGATTTGATGTAAATCACATTT
-82 4.4 TAAAGTGACCTGTCTCACACCT
Shewanella pealeana ATCC 700345 Spea_0734 -147 4.1 CGATATGATTTGGATCACTTTT
-82 4.2 AATAGTGATATACATCACAAGG
Shewanella halifaxensis HAW-EB4 Shal_0787 -81 4.9 AATAGTGATGCAGATCACACTG
Shewanella piezotolerans WP3 swp_4346 -4 4.6 TACTGTGATCGATATCACGTCT
Shewanella sediminis HAW-EB3 Ssed_0816 -321 3.9 AAACTCAATATAGTTCACATTT
-147 3.9 GGATATGATCTAAATCACACTG
Shewanella woodyi ATCC 51908 Swoo_3763 -82 4.3 TTGTGTGACCTGCATCACGCCA
Position: -116
Score: 4.5
Sequence: AATAGTGTTGTTGTTCACACTT
Locus tag: Shewmr4_0658
Shewmr4_0658 -116 4.5 AATAGTGTTGTTGTTCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: narQ
Ortholog function: Nitrate/nitrite sensor protein (EC 2.7.3.-)
Shewanella oneidensis MR-1 SO3981 -174 3.7 AAGTTTGCGCTAGATCAAAATG
-151 4.5 AATAGTGTTGTTGTTCACACTT
Shewanella putrefaciens CN-32 Sputcn32_0684 -114 4.5 AATAGTGTTGTTGTTCACACTT
Shewanella sp W3-18-1 Sputw3181_3487 -114 4.5 AATAGTGTTGTTGTTCACACTT
Shewanella sp ANA-3 Shewana3_0657 -138 3.7 AAGTTTGCGCTAGATCAAAATG
-115 4.5 AATAGTGTTGTTGTTCACACTT
Shewanella sp MR-4 Shewmr4_0658 -139 3.7 AAGTTTGCGCTAGATCAAAATG
-116 4.5 AATAGTGTTGTTGTTCACACTT
Shewanella sp MR-7 Shewmr7_3364 -139 3.7 AAGTTTGCGCTAGATCAAAATG
-116 4.5 AATAGTGTTGTTGTTCACACTT
Shewanella baltica OS155 Sbal_0793 -121 3.7 AAGTTTGCGCTAGATCAAAATG
-98 4.5 AAAGGTGTTGTTGTTCACATTT
Shewanella frigidimarina NCIMB 400 Sfri_0621 -140 3.9 AAACAGGATGTATCTCACAGTT
Shewanella amazonensis SB2B Sama_0647 -112 4 GGATGTGTTATTGTTCACACTT
Shewanella loihica PV-4 Shew_0843 -136 3.9 AAACTTGAGGCAGATCATAATG
-113 4.4 GAATGTGTTGTTGGTCACATTT
Shewanella pealeana ATCC 700345 Spea_0830 -109 4 GAACGTGTTGTTGCTCACACTT
-81 3.8 ATTTGTTAATGTAATCAAGTAT
Shewanella halifaxensis HAW-EB4 Shal_0885 -111 4.3 GAATGTGTTGTTGCTCACACTT
Shewanella sediminis HAW-EB3 Ssed_0930 -113 4.8 AAATGTGGTGTTGCTCACACTT
Shewanella woodyi ATCC 51908 Swoo_0971 -112 4.8 AAACGTGTTGTTGCTCACATTT
Position: -108
Score: 4.1
Sequence: CATTTTGATCTAGCGCAAACTT
Locus tag: Shewmr4_0659
Shewmr4_0659 -108 4.1 CATTTTGATCTAGCGCAAACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nrfA
Ortholog function: cytochrome c552 precursor (EC 1.7.2.2)
Shewanella oneidensis MR-1 SO3980 -149 3.9 AAGTGTGAACAACAACACTATT
-126 4.1 CATTTTGATCTAGCGCAAACTT
Shewanella putrefaciens CN-32 Sputcn32_0685 -149 3.9 AAGTGTGAACAACAACACTATT
-126 4.1 CATTTTGATCTGGCGCAAACTT
Shewanella sp W3-18-1 Sputw3181_3486 -149 3.9 AAGTGTGAACAACAACACTATT
-126 4.1 CATTTTGATCTGGCGCAAACTT
Shewanella sp ANA-3 Shewana3_0658 -131 3.9 AAGTGTGAACAACAACACTATT
-108 4.1 CATTTTGATCTAGCGCAAACTT
Shewanella sp MR-4 Shewmr4_0659 -131 3.9 AAGTGTGAACAACAACACTATT
-108 4.1 CATTTTGATCTAGCGCAAACTT
Shewanella sp MR-7 Shewmr7_3363 -131 3.9 AAGTGTGAACAACAACACTATT
-108 4.1 CATTTTGATCTAGCGCAAACTT
Shewanella baltica OS155 Sbal_0794 -149 4.4 AAATGTGAACAACAACACCTTT
-126 4.1 CATTTTGATCTAGCGCAAACTT
Shewanella loihica PV-4 Shew_0844 -156 4.5 AAATGTGACCAACAACACATTC
-133 4.2 CATTATGATCTGCCTCAAGTTT
Shewanella pealeana ATCC 700345 Spea_0831 -183 4 ATACTTGATTACATTAACAAAT
-155 3.8 AAGTGTGAGCAACAACACGTTC
-71 4.1 ATAAGTGATTAAATTCAACCTT
Shewanella halifaxensis HAW-EB4 Shal_0886 -152 4.2 AAGTGTGAGCAACAACACATTC
Shewanella piezotolerans WP3 swp_3958 -150 4 AAATGTGAGCAACAACACGTTC
Shewanella sediminis HAW-EB3 Ssed_0931 -154 4.6 AAGTGTGAGCAACACCACATTT
-131 3.9 CATTTTGATCTACCGCATACTT
Shewanella woodyi ATCC 51908 Swoo_0972 -154 4.4 AAATGTGAGCAACAACACGTTT
Position: -317
Score: 3.9
Sequence: AATTTTTATTTATATTAAAAAT
Position: -207
Score: 4.1
Sequence: AAATGTTATCTAGATGATATTA
Locus tag: Shewmr4_0666
Shewmr4_0666 -317 3.9 AATTTTTATTTATATTAAAAAT
-207 4.1 AAATGTTATCTAGATGATATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Sama_3096
Ortholog function: Outer membrane lipoprotein omp16 precursor
Shewanella amazonensis SB2B Sama_3096 -197 4 TAATGGTATTAATATCAAATAT
-40 3.7 AGTCGTTATACTGGCCACAAAA
Position: -125
Score: 4.2
Sequence: TTAAGTGATCTTGGCCACAATC
Locus tag: Shewmr4_0667
Shewmr4_0667 -125 4.2 TTAAGTGATCTTGGCCACAATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3967
Ortholog function: Molybdenum-binding periplasmic protein
Shewanella sp ANA-3 Shewana3_0666 -125 4.2 TTAAGTGATCTTGGCCACAATC
Shewanella sp MR-4 Shewmr4_0667 -125 4.2 TTAAGTGATCTTGGCCACAATC
Shewanella sp MR-7 Shewmr7_3355 -125 4.5 TTAAGTGATCTTGGCCACAATA
Shewanella baltica OS155 Sbal_3674 -136 4 TTGGGTGATCTGCACCACAATC
Shewanella amazonensis SB2B Sama_3095 -197 4 TAATGGTATTAATATCAAATAT
-40 3.7 AGTCGTTATACTGGCCACAAAA
Shewanella woodyi ATCC 51908 Swoo_4247 -91 3.8 AAGTGTTATAAACATCATTTTA
Position: -149
Score: 3.9
Sequence: AACTTTGATCCCGATCGACTAT
Locus tag: Shewmr4_0705
Shewmr4_0705 -149 3.9 AACTTTGATCCCGATCGACTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: napD
Ortholog function: periplasmic nitrate reductase component NapD
Shewanella oneidensis MR-1 SO0849 -260 3.9 TAATGTGATTGGTATAAACCTC
-150 3.9 AACTTTGATCCCGATCGACTAT
Shewanella putrefaciens CN-32 Sputcn32_3147 -147 3.9 AACTTTGATCCCGATCGACTAT
Shewanella sp W3-18-1 Sputw3181_0796 -147 3.9 AACTTTGATCCCGATCGACTAT
Shewanella sp ANA-3 Shewana3_3429 -149 3.9 AACTTTGATCCCGATCGACTAT
Shewanella sp MR-4 Shewmr4_0705 -149 3.9 AACTTTGATCCCGATCGACTAT
Shewanella sp MR-7 Shewmr7_3317 -149 3.9 AACTTTGATCCCGATCGACTAT
Shewanella baltica OS155 Sbal_3510 -150 4 AACTTTGATCCGGATCGACTAT
Shewanella loihica PV-4 Shew_3205 -154 3.8 AACTTTGATCTCGATCTACAAA
Shewanella pealeana ATCC 700345 Spea_0624 -173 4.3 ATTTGTGAACTAGATCAACACT
Shewanella halifaxensis HAW-EB4 Shal_0716 -174 4.2 ATCTGTGAATCAGATCACCATG
Shewanella sediminis HAW-EB3 Ssed_3956 -187 4.1 ATCTGAGACATAGGTCACACAT
Shewanella woodyi ATCC 51908 Swoo_4109 -179 4.4 AAATGTGAACTCCATCACGCAC
-155 3.9 AATATTGATCTTGATCGACTAA
Position: -143
Score: 3.9
Sequence: TTATGCGATATTGTTCTAATTC
Locus tag: Shewmr4_0718
Shewmr4_0718 -143 3.9 TTATGCGATATTGTTCTAATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: serA
Ortholog function: D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95)
Shewanella oneidensis MR-1 SO0862 -145 4.7 TTATGCGATATTGTTCTCATTT
Shewanella putrefaciens CN-32 Sputcn32_3139 -142 4.2 TTATGCGATATTGTTCTAAATT
Shewanella sp W3-18-1 Sputw3181_0804 -142 4.2 TTATGCGATATTGTTCTAAATT
Shewanella sp ANA-3 Shewana3_3416 -143 3.9 TTATGCGATATTGTTCTAATTC
Shewanella sp MR-4 Shewmr4_0718 -143 3.9 TTATGCGATATTGTTCTAATTC
Shewanella sp MR-7 Shewmr7_3304 -143 3.9 TTATGCGATATTGTTCTAATTC
Shewanella baltica OS155 Sbal_3502 -142 4.1 TTATGCGATATTGTTCTTAATT
Shewanella amazonensis SB2B Sama_2949 -144 4.2 TTATGTGATATTGTTCTGGTTT
Position: -339
Score: 3.8
Sequence: CACAGTGATCTTGATCAAGCTT
Position: -182
Score: 3.8
Sequence: TTATGTGATCTTTTTGATGCAT
Locus tag: Shewmr4_0761
Shewmr4_0761 -339 3.8 CACAGTGATCTTGATCAAGCTT
-182 3.8 TTATGTGATCTTTTTGATGCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0919
Ortholog function: Serine transporter, putative
Shewanella sp ANA-3 Shewana3_3365 -307 3.9 TTAATTGAAGCTGGTCGCATTT
Shewanella loihica PV-4 Shew_0739 -188 3.9 AAGTTAGATTCGGCTCACAAAG
Shewanella piezotolerans WP3 swp_4263 -161 4 ATAAGCGATATAGCTCCCAATA
Shewanella woodyi ATCC 51908 Swoo_0863 -196 4.2 AACTGAGAGGTGGATCACATTG
Position: -239
Score: 4.3
Sequence: CAATGTGATTGATATCAATAAA
Locus tag: Shewmr4_0778
Shewmr4_0778 -239 4.3 CAATGTGATTGATATCAATAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nhaD
Ortholog function: Na+/H+ antiporter NhaD type
Shewanella oneidensis MR-1 SO0935 -278 4.3 CAATGTGATTGCTATCAACATA
Shewanella sp ANA-3 Shewana3_3348 -239 4.3 CAATGTGATTGATATCAATAAA
Shewanella sp MR-4 Shewmr4_0778 -239 4.3 CAATGTGATTGATATCAATAAA
Shewanella sp MR-7 Shewmr7_3245 -239 4.3 CAATGTGATTGATATCAATAAA
Shewanella amazonensis SB2B Sama_2753 -112 3.9 AATTTTTACGTGATTCAGATAA
-107 4.1 TTACGTGATTCAGATAAAGCTT
-87 4.7 TTTTGTGGTGTATTTCGCATTT
Shewanella loihica PV-4 Shew_0699 -227 3.8 AAGCGTGATCCTGTGCTAACTT
-77 4.2 AAACTTGAGGCGCATCAAAATT
Position: -118
Score: 4.5
Sequence: TTTATTGATGCATTTCACAGAT
Locus tag: Shewmr4_0779
Shewmr4_0779 -118 4.5 TTTATTGATGCATTTCACAGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cadC
Ortholog function: transcriptional regulator-related protein
Shewanella oneidensis MR-1 SO0936 -117 4.6 TTTATTGATGTAATTCACAGAT
Shewanella sp ANA-3 Shewana3_3347 -118 4.6 TTTATTGATGTGTTTCACAGAT
Shewanella sp MR-4 Shewmr4_0779 -118 4.5 TTTATTGATGCATTTCACAGAT
Shewanella sp MR-7 Shewmr7_3244 -118 4.5 TTTATTGATGCATTTCACAGAT
Shewanella loihica PV-4 Shew_0757 -115 4.3 TTATGTGCTGATTGTCACGAAA
Shewanella halifaxensis HAW-EB4 Shal_0849 -117 4.4 TAGTGTGCTAGACCTCACGAAA
Shewanella piezotolerans WP3 swp_4239 -248 4.2 TAACGTGCTAAAGCTCACGAAA
Shewanella sediminis HAW-EB3 Ssed_0879 -117 4.1 TAACGTGTTCCTTGTCACGAAT
Shewanella woodyi ATCC 51908 Swoo_0881 -116 3.7 ATATGAGCGCTAAATCACGCTT
Position: -217
Score: 4
Sequence: TAATGTGCGTTGATGCACATTG
Locus tag: Shewmr4_0782
Shewmr4_0782 -217 4 TAATGTGCGTTGATGCACATTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0939
Ortholog function: split-soret diheme cytochrome c
Shewanella oneidensis MR-1 SO0939 -382 4.3 TACTGTGATCCCGTTAACCCAA
-217 4.6 TATCGTGCCTTCGCTCACATTA
Shewanella putrefaciens CN-32 Sputcn32_0879 -388 4.4 TACTGTGATCTTGCTAACCCAA
Shewanella sp W3-18-1 Sputw3181_3294 -388 4.4 TACTGTGATCTTGCTAACCCAA
-253 3.5 AAATGGATTTAAATTCACATAA
Shewanella sp ANA-3 Shewana3_3344 -384 4.3 TACTGTGATCCCGTTAACCCAA
-217 3.8 TAATGTGCGCTGCCGCAAATTG
Shewanella sp MR-4 Shewmr4_0782 -383 4.3 TACTGTGATCCCGTTAACCCAA
-217 4 TAATGTGCGTTGATGCACATTG
Shewanella sp MR-7 Shewmr7_3241 -383 4.3 TACTGTGATCCCGTTAACCCAA
-217 3.9 TAATGTGCGCAGGCACACATTG
Shewanella loihica PV-4 Shew_0759 -246 4.1 TAGAGTGATCAGCTTCACATCG
Shewanella sediminis HAW-EB3 Ssed_0882 -349 4.1 TTTTGCGAACAAAATCACACTG
Position: -246
Score: 3.8
Sequence: CAATGTGCATCAACGCACATTA
Locus tag: Shewmr4_0783
Shewmr4_0783 -246 3.8 CAATGTGCATCAACGCACATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cadC
Ortholog function: transcriptional regulator-related protein
Shewanella oneidensis MR-1 SO0940 -246 4.3 TAATGTGAGCGAAGGCACGATA
Shewanella sp MR-4 Shewmr4_0783 -246 3.8 CAATGTGCATCAACGCACATTA
Shewanella sp MR-7 Shewmr7_3240 -246 3.8 CAATGTGTGCCTGCGCACATTA
Shewanella baltica OS155 Sbal_0833 -75 4 TTGGGTTAGCAAGATCACATTA
Shewanella frigidimarina NCIMB 400 Sfri_3632 -334 4.6 AAATGTGATTCAAAGCAGATAA
-234 4.3 TTTCATGATGTAAGTCTCATTA
-156 5 TGACGTGATATCGCTCACAAAT
Shewanella loihica PV-4 Shew_0760 -234 3.9 CGATGTGAAGCTGATCACTCTA
Shewanella pealeana ATCC 700345 Spea_3438 -227 4.2 TTTCATGAACGATGTCACATTA
-149 3.8 GAGTGTGACTAACGTCTCATTT
Shewanella halifaxensis HAW-EB4 Shal_3519 -227 4.6 TTCTGTGACCGATAGCACATTA
-149 4.4 CTGTGTGATTAACCTCTCATTT
Shewanella piezotolerans WP3 swp_4010 -258 4.3 TTTATTGATCTAGATCTAATAA
Shewanella sediminis HAW-EB3 Ssed_0883 -147 4.7 CAGTGTGATTTTGTTCGCAAAA
Shewanella woodyi ATCC 51908 Swoo_0885 -232 4.2 AATGGTGAGCTGGATCATGTTA
-145 4.5 CAATGTGATCCTCTTCGCAAAC
Position: -166
Score: 4.3
Sequence: AAGTGTTATGCCTATCCCATAT
Locus tag: Shewmr4_0857
Shewmr4_0857 -166 4.3 AAGTGTTATGCCTATCCCATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3699.1
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO3699.1 -183 4 AAGTGTTACACCTATCCCATAT
Shewanella putrefaciens CN-32 Sputcn32_2996 -183 4 AAGTGTTACGCCTATCCCAAAT
Shewanella sp W3-18-1 Sputw3181_0951 -185 4 AAGTGTTACGCCTATCCCAAAT
Shewanella sp ANA-3 Shewana3_3266 -176 4.3 AAATGTTACGCCTATCCCATAT
Shewanella sp MR-4 Shewmr4_0857 -166 4.3 AAGTGTTATGCCTATCCCATAT
Shewanella sp MR-7 Shewmr7_3165 -166 4.3 AAATGTTACGCCTATCCCATAT
Position: -166
Score: 3.7
Sequence: TGACGTGATTTGTGGCGTATAA
Locus tag: Shewmr4_0873
Shewmr4_0873 -166 3.7 TGACGTGATTTGTGGCGTATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3682
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO3682 -109 3.8 TTGCGTGATTTTGTGCAAGCAT
Shewanella putrefaciens CN-32 Sputcn32_2981 -76 3.8 ATTTTTGAGCAAGATCACGGCT
Shewanella sp W3-18-1 Sputw3181_0966 -76 3.8 ATTTTTGAGCAAGATCACGGCT
Shewanella sp MR-4 Shewmr4_0873 -166 3.7 TGACGTGATTTGTGGCGTATAA
Shewanella sp MR-7 Shewmr7_3149 -166 3.7 TGACGTGATTTGTGGCGTATAA
Shewanella baltica OS155 Sbal_3331 -76 3.7 ATTTTTGAGCAATATCACGGCT
Shewanella amazonensis SB2B Sama_2854 -78 4 AAACTTGATCTGGATCACGAGT
Shewanella loihica PV-4 Shew_3102 -84 4.2 AAATGTGATCTGGATCAAGTGG
Shewanella pealeana ATCC 700345 Spea_3356 -102 4.7 AATTGTGAGCTAGATCAAACTC
Shewanella halifaxensis HAW-EB4 Shal_3428 -90 4.8 AATTGTGACTGAGATCAAATTC
Shewanella piezotolerans WP3 swp_1054 -79 4.3 TTTTGTGAGCAAGATCAACTTC
Shewanella sediminis HAW-EB3 Ssed_3715 -111 4.2 CAGTGTGATCTCGATCAACTTC
Position: -129
Score: 4.3
Sequence: CAGCGTGATTGCGATCGCATTT
Locus tag: Shewmr4_0936
Shewmr4_0936 -129 4.3 CAGCGTGATTGCGATCGCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nqrA-2
Ortholog function: Na(+)-translocating NADH-quinone reductase subunit A (EC 1.6.5.-)
Shewanella oneidensis MR-1 SO1103 -129 4.3 CAGCGTGATTGCGATCGCATTT
Shewanella putrefaciens CN-32 Sputcn32_0940 -129 4.3 CAGCGTGATTGCGATCGCATTT
Shewanella sp W3-18-1 Sputw3181_3236 -129 4.3 CAGCGTGATTGCGATCGCATTT
Shewanella sp ANA-3 Shewana3_0938 -129 4.3 CAGCGTGATTGCGATCGCATTT
Shewanella sp MR-4 Shewmr4_0936 -129 4.3 CAGCGTGATTGCGATCGCATTT
Shewanella sp MR-7 Shewmr7_0974 -129 4.3 CAGCGTGATTGCGATCGCATTT
Shewanella baltica OS155 Sbal_0924 -128 4.3 CAGCGTGATTGCGATCGCATTT
Shewanella denitrificans OS217 Sden_0982 -128 4.3 CAGCGTGATTGCGATCGCATTA
Shewanella frigidimarina NCIMB 400 Sfri_0949 -127 4.3 CAGCGTGATTATGATCGCATTT
Shewanella amazonensis SB2B Sama_2539 -127 4.3 CAGCGTGATTGCGATCGCATTT
Shewanella loihica PV-4 Shew_2881 -131 4.3 CAGCGTGATTGCGATCGCATTT
-73 4.1 ATGTTTGAAATCTATCTCATTT
Shewanella pealeana ATCC 700345 Spea_3103 -133 4.4 CAGCGTGATTCTGATCGCATTT
Shewanella halifaxensis HAW-EB4 Shal_3187 -127 3.7 CAGCGTGATTACAGTCGCACTT
Shewanella piezotolerans WP3 swp_1167 -132 4.3 CAGCGTGATTGCGATCGCATTT
Shewanella sediminis HAW-EB3 Ssed_3431 -130 4.1 CAGCGTGATTGCGGTCGCATTT
Shewanella woodyi ATCC 51908 Swoo_3617 -46 4 CAGCGTGATTGCGGTCGCAAAT
Position: -84
Score: 4.9
Sequence: ATTTGTTACATTTATCACATAA
Locus tag: Shewmr4_0950
Shewmr4_0950 -84 4.9 ATTTGTTACATTTATCACATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Sbal_2136
Ortholog function: putative OMR family iron-siderophore receptor precursor
Shewanella putrefaciens CN-32 Sputcn32_3863 -48 4.7 GTTTGTTATCTATATCACATAA
Shewanella sp W3-18-1 Sputw3181_0090 -48 4.5 GTTTGTTATCTATATCACACAA
Shewanella sp ANA-3 Shewana3_0952 -117 3.7 TTATTTGATACGACTTAAGAAT
-90 5.1 ATTTGTTATATTTATCACATAA
Shewanella sp MR-4 Shewmr4_0950 -84 4.9 ATTTGTTACATTTATCACATAA
Shewanella sp MR-7 Shewmr7_0988 -84 4.9 ATTTGTTACATTTATCACATAA
Shewanella baltica OS155 Sbal_2136 -169 3.7 TGCTGTGAGCTTTCTCTTAAAT
-89 4.5 ATATGTTATCCGAATCACTAAA
Position: -74
Score: 5.2
Sequence: AAATGTGATCTGTCTTACATTT
Locus tag: Shewmr4_0985
Shewmr4_0985 -74 5.2 AAATGTGATCTGTCTTACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: lipB
Ortholog function: Octanoate-[acyl-carrier-protein]-protein-N-octanoyltransferase
Shewanella oneidensis MR-1 SO1162 -68 5.1 AAGTGTGATCTATCTTACATTT
Shewanella putrefaciens CN-32 Sputcn32_2875 -69 5.3 AAATGTGATCTATCTTACATTT
Shewanella sp W3-18-1 Sputw3181_1028 -75 5.3 AAATGTGATCTATCTTACATTT
Shewanella sp ANA-3 Shewana3_0989 -74 5.2 AAATGTGATCTGTCTTACATTT
Shewanella sp MR-4 Shewmr4_0985 -74 5.2 AAATGTGATCTGTCTTACATTT
Shewanella sp MR-7 Shewmr7_1050 -74 5.2 AAATGTGATCTGTCTTACATTT
Shewanella baltica OS155 Sbal_3281 -74 5.2 AAATGTGATCTGTCTTACATTT
Shewanella loihica PV-4 Shew_2941 -70 5.3 AAATGTGATCTACCTTACATTT
Shewanella pealeana ATCC 700345 Spea_3155 -76 5.2 AAATGTGATCCGTATTACATTT
Shewanella halifaxensis HAW-EB4 Shal_3240 -76 5.2 AAATGTGATCCGTATTACATTT
Shewanella piezotolerans WP3 swp_3928 -69 5.2 AAATGTGATCTGTCTTACATTT
Shewanella sediminis HAW-EB3 Ssed_3491 -75 5.3 AAATGTGATCTAGCTTACATTT
Shewanella woodyi ATCC 51908 Swoo_3714 -74 5.1 AAGTGTGATCTAGCTTACAATT
Position: -144
Score: 4.2
Sequence: AGTCGCGACTTTGTTCACAATT
Locus tag: Shewmr4_1036
Shewmr4_1036 -144 4.2 AGTCGCGACTTTGTTCACAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: tsx
Ortholog function: nucleoside-specific channel-forming protein, Tsx
Shewanella putrefaciens CN-32 Sputcn32_2823 -268 3.8 AATAGTGATTTCTGTCGTGAAT
Shewanella sp W3-18-1 Sputw3181_1188 -268 3.8 AATAGTGATTTCTGTCGTGAAT
Shewanella sp ANA-3 Shewana3_1040 -144 4.2 AGTCGCGACTTTGTTCACAATT
Shewanella sp MR-4 Shewmr4_1036 -144 4.2 AGTCGCGACTTTGTTCACAATT
Shewanella sp MR-7 Shewmr7_1101 -144 4.2 AGTCGCGACTTTGTTCACAATT
Shewanella baltica OS155 Sbal_3228 -145 4.2 AGTCGCGACTTTGTTCACAATT
Shewanella denitrificans OS217 Sden_1024 -145 4 AGTCACGATATTGTTCACATAT
Shewanella frigidimarina NCIMB 400 Sfri_1001 -146 4.2 AGTCGCGACATTGTTCACAAAA
Shewanella loihica PV-4 Shew_2816 -99 4 TATTGTGATTTAATACAATTTG
Shewanella sediminis HAW-EB3 Ssed_3379 -245 3.9 CTGTGTGAGGATAAACACAATT
Shewanella woodyi ATCC 51908 Swoo_3550 -103 3.7 TGTTGTGCTTTAGCACAGAATA
Position: -135
Score: 3.9
Sequence: AAGTGTGACCTAAATCTAGTTG
Locus tag: Shewmr4_1038
Shewmr4_1038 -135 3.9 AAGTGTGACCTAAATCTAGTTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: deoA
Ortholog function: thymidine phosphorylase (EC 2.4.2.4)
Shewanella oneidensis MR-1 SO1218 -135 3.9 AAGTGTGACCTAAATCTAGTTG
Shewanella putrefaciens CN-32 Sputcn32_2821 -136 3.7 AAGTGTGACCTAAATCTATTTG
Shewanella sp W3-18-1 Sputw3181_1190 -136 3.7 AAGTGTGACCTAAATCTATTTG
Shewanella sp ANA-3 Shewana3_1042 -135 3.9 AAGTGTGACCTAAATCTAGTTG
Shewanella sp MR-4 Shewmr4_1038 -135 3.9 AAGTGTGACCTAAATCTAGTTG
Shewanella sp MR-7 Shewmr7_1103 -135 3.9 AAGTGTGACCTAAATCTAGTTG
Shewanella baltica OS155 Sbal_3226 -136 3.7 AAGTGTGACCTAAATCTATTTG
Shewanella amazonensis SB2B Sama_0974 -135 3.9 ATTTGTGATCCGCGTCGAAACG
Shewanella loihica PV-4 Shew_2814 -133 4 AAGTGTGATCTAAATCTATTTG
Shewanella pealeana ATCC 700345 Spea_3047 -138 4.8 AAGTGTGATCTAAATCTAATTA
Shewanella halifaxensis HAW-EB4 Shal_3135 -138 4.8 AAGTGTGATCTAAATCTAATTA
Shewanella piezotolerans WP3 swp_1230 -139 4.8 AAGTGTGATCTAAATCTAATTA
Shewanella sediminis HAW-EB3 Ssed_3377 -134 4 AAGTGTGATCTAAATCTATTTG
Shewanella woodyi ATCC 51908 Swoo_3548 -157 4.2 AAGTGTGATCTAAATCTAGTTG
Position: -273
Score: 4.3
Sequence: CAATGTGAGCTAGTTAACATCA
Locus tag: Shewmr4_1059
Shewmr4_1059 -273 4.3 CAATGTGAGCTAGTTAACATCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1247
Ortholog function: hypothetical protein
Shewanella sp MR-4 Shewmr4_1059 -273 4.3 CAATGTGAGCTAGTTAACATCA
Shewanella sp MR-7 Shewmr7_1131 -273 4.3 CAATGTGAGCTAGTTAACATCA
Shewanella baltica OS155 Sbal_3204 -159 3.8 AATAGTGATCTTTCTCAGCATC
Shewanella amazonensis SB2B Sama_0996 -108 3.8 TCATGTGAGCCAGGTTAAAAAA
Shewanella pealeana ATCC 700345 Spea_3022 -187 4.1 TTTAGTGATGTTTTTTAGATTA
Shewanella woodyi ATCC 51908 Swoo_3518 -312 4.8 TTTTGTGAATTGTATCACTTAT
Position: -78
Score: 5.1
Sequence: AAATGTGATTTAGATCTCGTTT
Locus tag: Shewmr4_1132
Shewmr4_1132 -78 5.1 AAATGTGATTTAGATCTCGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfiA-2
Ortholog function: Ribosome hibernation protein YfiA
Shewanella oneidensis MR-1 SO3422 -78 4.7 AAGTGTGATTTAACTCTCGTTT
Shewanella putrefaciens CN-32 Sputcn32_2740 -77 5.1 TTTTGTGATTTAGATCTCGTTT
Shewanella sp W3-18-1 Sputw3181_1272 -77 5.1 TTTTGTGATTTAGATCTCGTTT
Shewanella sp ANA-3 Shewana3_1133 -78 5.1 AAATGTGATTTAGATCTCGTTT
Shewanella sp MR-4 Shewmr4_1132 -78 5.1 AAATGTGATTTAGATCTCGTTT
Shewanella sp MR-7 Shewmr7_1203 -78 5.1 AAATGTGATTTAGATCTCGTTT
Shewanella baltica OS155 Sbal_1221 -77 5.2 AAATGTGATCTAGATCTCGTTT
Shewanella denitrificans OS217 Sden_2746 -77 4.8 AAGTGTGACTTTGATCACGCTT
-38 4.1 TAATCTGAAGTTAAGCACATAA
Shewanella frigidimarina NCIMB 400 Sfri_2912 -77 5 AAGTGTGATGCAGATCACTATT
Shewanella amazonensis SB2B Sama_0899 -78 4.3 AAACGTGATTTTACTCACGACT
Shewanella loihica PV-4 Shew_1073 -76 4.6 AAAGTTGATCTAGATCACGTTT
Shewanella pealeana ATCC 700345 Spea_1060 -76 4.6 AAACGTGATTTAGATCACGACT
Shewanella halifaxensis HAW-EB4 Shal_4284 -83 4.6 AAACATGACCTAGATCACACTA
-58 3.8 TAATGTGATTGGACTATTGTAA
Shewanella halifaxensis HAW-EB4 Shal_1108 -76 4.6 AAACGTGATTTAGATCACGACT
Shewanella piezotolerans WP3 swp_3757 -76 4.6 AAACGTGATTTAGATCACGACT
Shewanella sediminis HAW-EB3 Ssed_1169 -222 3.8 TTTTGAGAGGCAAATAAAAAAA
-76 4.6 AAACGTGATTTAGATCACGACT
Shewanella woodyi ATCC 51908 Swoo_1264 -76 4.5 AAACGTGATCAAGATCACGACT
Position: -241
Score: 4.9
Sequence: AAACGAGATCTAAATCACATTT
Locus tag: Shewmr4_1133
Shewmr4_1133 -241 4.9 AAACGAGATCTAAATCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3421
Ortholog function: b-type cytochrome, putative
Shewanella oneidensis MR-1 SO3421 -244 4.2 AAACGAGAGTTAAATCACACTT
Shewanella putrefaciens CN-32 Sputcn32_2739 -242 4.8 AAACGAGATCTAAATCACAAAA
Shewanella sp W3-18-1 Sputw3181_1273 -242 4.8 AAACGAGATCTAAATCACAAAA
Shewanella sp ANA-3 Shewana3_1134 -241 4.9 AAACGAGATCTAAATCACATTT
Shewanella sp MR-4 Shewmr4_1133 -241 4.9 AAACGAGATCTAAATCACATTT
Shewanella sp MR-7 Shewmr7_1204 -241 4.9 AAACGAGATCTAAATCACATTT
Shewanella baltica OS155 Sbal_1222 -244 5 AAACGAGATCTAGATCACATTT
Shewanella denitrificans OS217 Sden_2745 -291 4.7 AAGCGTGATCAAAGTCACACTT
Shewanella frigidimarina NCIMB 400 Sfri_2911 -383 5.2 AATAGTGATCTGCATCACACTT
Shewanella amazonensis SB2B Sama_0900 -234 4.2 AGTCGTGAGTAAAATCACGTTT
Shewanella loihica PV-4 Shew_1074 -208 4.9 AAACGTGATCTAGATCAACTTT
Shewanella pealeana ATCC 700345 Spea_1061 -255 4.9 AGTCGTGATCTAAATCACGTTT
Shewanella halifaxensis HAW-EB4 Shal_1109 -255 4.9 AGTCGTGATCTAAATCACGTTT
Shewanella piezotolerans WP3 swp_3756 -366 4.9 AGTCGTGATCTAAATCACGTTT
Shewanella sediminis HAW-EB3 Ssed_1170 -236 4.9 AGTCGTGATCTAAATCACGTTT
Shewanella woodyi ATCC 51908 Swoo_1265 -234 4.9 AGTCGTGATCTTGATCACGTTT
Position: -85
Score: 5
Sequence: AGATGTGACTTGCCTCACAATT
Locus tag: Shewmr4_1141
Shewmr4_1141 -85 5 AGATGTGACTTGCCTCACAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: swp_3747
Ortholog function: hypothetical protein
Shewanella sp ANA-3 Shewana3_1142 -85 4.4 GGATGTGAGTTGCTTCACAATT
Shewanella sp ANA-3 Shewana3_1142 -85 4.4 GGATGTGAGTTGCTTCACAATT
Shewanella sp MR-4 Shewmr4_1141 -85 5 AGATGTGACTTGCCTCACAATT
Shewanella sp MR-4 Shewmr4_1141 -85 5 AGATGTGACTTGCCTCACAATT
Shewanella sp MR-7 Shewmr7_1212 -85 4.4 GGATGTGACTTGCCTCACAATT
Shewanella sp MR-7 Shewmr7_1212 -85 4.4 GGATGTGACTTGCCTCACAATT
Shewanella baltica OS155 Sbal_1230 -78 5.5 AAATGTGATTAAGTTCACAATT
Shewanella baltica OS155 Sbal_1230 -78 5.5 AAATGTGATTAAGTTCACAATT
Shewanella pealeana ATCC 700345 Spea_1069 -77 4.4 CTGTGCGATCTGTGTCACAATT
Shewanella pealeana ATCC 700345 Spea_1069 -77 4.4 CTGTGCGATCTGTGTCACAATT
Shewanella halifaxensis HAW-EB4 Shal_1117 -77 3.8 CGGTGCGATCTGTATCACTATT
Shewanella halifaxensis HAW-EB4 Shal_1117 -77 3.8 CGGTGCGATCTGTATCACTATT
Position: -278
Score: 4.8
Sequence: ATTTGTGACAAATTGCACATTA
Position: -205
Score: 4.1
Sequence: ATTCGTTAGGGATCTCACAGAT
Locus tag: Shewmr4_1148
Shewmr4_1148 -278 4.8 ATTTGTGACAAATTGCACATTA
-205 4.1 ATTCGTTAGGGATCTCACAGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3406
Ortholog function: FIG024006: iron uptake protein
Shewanella oneidensis MR-1 SO3406 -298 3.8 ATTTGTGCACAGCATCAACAAA
Shewanella sp MR-4 Shewmr4_1148 -278 4.8 ATTTGTGACAAATTGCACATTA
-205 4.1 ATTCGTTAGGGATCTCACAGAT
Shewanella sp MR-7 Shewmr7_1219 -278 4.8 ATTTGTGACAAATTGCACATTA
-205 4.1 ATTCGTTAGGGAACTCACAGAT
Shewanella woodyi ATCC 51908 Swoo_3307 -141 4.1 ATATGAGATGCAGCTCTCATCT
Position: -142
Score: 4.6
Sequence: TTCTTTGATAAATCTCACATTT
Locus tag: Shewmr4_1150
Shewmr4_1150 -142 4.6 TTCTTTGATAAATCTCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yfiA-1
Ortholog function: ribosomal subunit interface protein
Shewanella oneidensis MR-1 SO3403 -142 4.7 TTCTTTGATAGGTCTCACATTT
Shewanella putrefaciens CN-32 Sputcn32_2725 -145 4.9 TTCTTTGATGTAACTCACATTT
Shewanella sp W3-18-1 Sputw3181_1287 -145 4.9 TTCTTTGATGTAACTCACATTT
Shewanella sp ANA-3 Shewana3_1151 -142 4.6 TTCTTTGATAAGTCTCACATTT
Shewanella sp MR-4 Shewmr4_1150 -142 4.6 TTCTTTGATAAATCTCACATTT
Shewanella sp MR-7 Shewmr7_1221 -142 5 TTTTTTGATAAATCTCACATTT
Shewanella baltica OS155 Sbal_1239 -222 4.2 TTTTGTGATTGATTTATTATTA
-144 4.3 CTTCTTGATGGCGGTCACATTT
Shewanella halifaxensis HAW-EB4 Shal_1258 -319 3.9 AAGAGTGATAAAAATCAAGCTA
-230 3.8 TATCCTGATGAATGCCACAATT
Shewanella piezotolerans WP3 swp_3408 -177 4.1 TGATGTGATAAAAAGCACTCAT
Position: -261
Score: 4.2
Sequence: AGTTGTGATCTTTGGCGCGTAT
Locus tag: Shewmr4_1156
Shewmr4_1156 -261 4.2 AGTTGTGATCTTTGGCGCGTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3395
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO3395 -257 4.1 AGATGTGATCGGTTGCGCGAAT
Shewanella putrefaciens CN-32 Sputcn32_2722 -259 3.7 AAACGTGATCAGTTACCCGTAA
Shewanella sp W3-18-1 Sputw3181_1290 -259 3.7 AAACGTGATCAGTTACCCGTAA
Shewanella sp ANA-3 Shewana3_1157 -261 4.2 AGTTGTGATCTTTGGCGCGTAT
Shewanella sp MR-4 Shewmr4_1156 -261 4.2 AGTTGTGATCTTTGGCGCGTAT
Shewanella sp MR-7 Shewmr7_1227 -260 4.2 ACTTGTGATCTTTAGCGCGTAT
Position: -203
Score: 4.2
Sequence: TAGTGTGACTAGGGTCTCAGTA
Locus tag: Shewmr4_1239
Shewmr4_1239 -203 4.2 TAGTGTGACTAGGGTCTCAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cydA
Ortholog function: cytochrome d ubiquinol oxidase, subunit I, CydA
Shewanella oneidensis MR-1 SO3286 -203 4.2 TAGTGTGACTAGGGTCTCAGTA
Shewanella putrefaciens CN-32 Sputcn32_2641 -204 4.3 TAGTGTGACGCTTGTCCCAATA
Shewanella sp W3-18-1 Sputw3181_1366 -204 4.3 TAGTGTGACGCTTGTCCCAATA
Shewanella sp ANA-3 Shewana3_1241 -203 4.2 TAGTGTGACTAGGGTCTCAGTA
Shewanella sp MR-4 Shewmr4_1239 -203 4.2 TAGTGTGACTAGGGTCTCAGTA
Shewanella sp MR-7 Shewmr7_1310 -203 4.2 TAGTGTGACTAGGGTCTCAGTA
Shewanella baltica OS155 Sbal_2979 -207 4.4 TAGTGTGACTCGCGTCTCAATA
Shewanella denitrificans OS217 Sden_1274 -157 4.1 TAAATTGATCTAAATCAATTTA
Shewanella frigidimarina NCIMB 400 Sfri_1142 -240 4.2 AAATCTAATGCTGGTCACATAA
Shewanella loihica PV-4 Shew_1302 -206 4.7 TTTTGTGAGCCGCCTCTCAAAA
Shewanella pealeana ATCC 700345 Spea_1318 -235 4 ATTCGGGATGGGTGTCACAAAG
Shewanella halifaxensis HAW-EB4 Shal_1381 -234 4.1 ATTTGGGATGAGTATCACGGAA
Shewanella piezotolerans WP3 swp_1469 -231 4.2 AGGTGAGACGGTGATCACAATA
Shewanella sediminis HAW-EB3 Ssed_3118 -203 4 TAGTGTGAAGTTCGTCGTAAAA
Shewanella woodyi ATCC 51908 Swoo_1565 -204 3.8 TTTTGTGAGATCGGTCGGAAAG
Position: -186
Score: 4.3
Sequence: AAACGCGATCTTTATCACTATT
Position: -51
Score: 3.8
Sequence: AAACGGGATATATATCGCCCTA
Locus tag: Shewmr4_1375
Shewmr4_1375 -186 4.3 AAACGCGATCTTTATCACTATT
-51 3.8 AAACGGGATATATATCGCCCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3120
Ortholog function: oxidoreductase, Gfo/Idh/MocA family
Shewanella oneidensis MR-1 SO3120 -186 4.3 AAACGCGATCTTTATCACTATT
Shewanella putrefaciens CN-32 Sputcn32_2490 -173 4.3 AAACGCGATCTTTATCACTATT
Shewanella sp W3-18-1 Sputw3181_1518 -173 4.3 AAACGCGATCTTTATCACTATT
Shewanella sp ANA-3 Shewana3_1428 -187 4.3 AAACGCGATCTTTATCACTATT
Shewanella sp MR-4 Shewmr4_1375 -186 4.3 AAACGCGATCTTTATCACTATT
Shewanella sp MR-7 Shewmr7_1440 -186 4.3 AAACGCGATCTTTATCACTATT
Shewanella baltica OS155 Sbal_2793 -202 4.3 AAACGCGATCTTTATCACTATT
Shewanella pealeana ATCC 700345 Spea_1465 -158 4 AAACGCGATATAAATCACTTTC
Shewanella halifaxensis HAW-EB4 Shal_1548 -207 4 AAACGCGATATAAATCACTTTC
Shewanella piezotolerans WP3 swp_1670 -185 3.7 AAACGCGATTTAAGTCACTTTC
Shewanella woodyi ATCC 51908 Swoo_1749 -214 4.2 AAACGCGATCTAAGTCACTTAA
Position: -171
Score: 4.5
Sequence: AATAGTGATAAAGATCGCGTTT
Locus tag: Shewmr4_1376
Shewmr4_1376 -171 4.5 AATAGTGATAAAGATCGCGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3119
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO3119 -166 4.5 AATAGTGATAAAGATCGCGTTT
Shewanella putrefaciens CN-32 Sputcn32_2489 -171 4.5 AATAGTGATAAAGATCGCGTTT
Shewanella sp W3-18-1 Sputw3181_1519 -171 4.5 AATAGTGATAAAGATCGCGTTT
Shewanella sp ANA-3 Shewana3_1429 -171 4.5 AATAGTGATAAAGATCGCGTTT
Shewanella sp MR-4 Shewmr4_1376 -171 4.5 AATAGTGATAAAGATCGCGTTT
Shewanella sp MR-7 Shewmr7_1441 -171 4.5 AATAGTGATAAAGATCGCGTTT
Shewanella baltica OS155 Sbal_2792 -171 4.5 AATAGTGATAAAGATCGCGTTT
Shewanella amazonensis SB2B Sama_2198 -151 4.4 AATAGTGATTAAGCTCGCGTTT
Shewanella pealeana ATCC 700345 Spea_1466 -148 4.1 GAAAGTGATTTATATCGCGTTT
Shewanella halifaxensis HAW-EB4 Shal_1549 -148 4.1 GAAAGTGATTTATATCGCGTTT
Shewanella piezotolerans WP3 swp_1671 -220 3.8 GAAAGTGACTTAAATCGCGTTT
Shewanella sediminis HAW-EB3 Ssed_2897 -173 4.7 TAAAGTGATTTAGATCGCGTTT
Shewanella woodyi ATCC 51908 Swoo_1750 -148 4.4 TTAAGTGACTTAGATCGCGTTT
Position: -73
Score: 3.8
Sequence: TAATGGGTTCTTGCTCAAACAT
Position: 11
Score: 3.7
Sequence: AACCCCGATTTTAATCACATTT
Locus tag: Shewmr4_1398
Shewmr4_1398 -73 3.8 TAATGGGTTCTTGCTCAAACAT
11 3.7 AACCCCGATTTTAATCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: putP
Ortholog function: proline/sodium symporter PutP (TC 2.A.21.2.1) @ propionate/sodium symporter
Shewanella putrefaciens CN-32 Sputcn32_2469 -60 4.2 AGGTTAGATTTTGATCACATTT
-30 3.8 TAATGGGTTCTTGCTCAAACAT
Shewanella sp W3-18-1 Sputw3181_1539 -60 4.4 ATGTTAGATTTTGATCACATTT
-30 3.8 TAATGGGTTCTTGCTCAAACAT
Shewanella sp ANA-3 Shewana3_1451 -73 3.8 TAATGGGTTCTTGCTCAAACAT
Shewanella sp MR-4 Shewmr4_1398 -73 3.8 TAATGGGTTCTTGCTCAAACAT
Shewanella sp MR-7 Shewmr7_1463 -73 3.8 TAATGGGTTCTTGCTCAAACAT
Shewanella baltica OS155 Sbal_2770 -102 3.8 AGGTTAGATTTTAATCACACTT
Shewanella frigidimarina NCIMB 400 Sfri_2686 -64 4.5 AAGTGTGAACTAGATCGAACTT
Shewanella amazonensis SB2B Sama_2177 -77 3.8 AATTGGGATCCGACCCAAACTT
Shewanella pealeana ATCC 700345 Spea_2608 -104 3.8 TGGTTAGATCTTCATCACATTC
Shewanella halifaxensis HAW-EB4 Shal_2680 -74 3.7 ATTTGAGCCTTGGCTCATAAAT
Shewanella piezotolerans WP3 swp_3151 -72 3.7 ATTATTGAGCTATAGCTCAAAT
-70 4.3 TATTGAGCTATAGCTCAAATAT
Shewanella sediminis HAW-EB3 Ssed_1619 -72 3.9 TATTGAGCTTCCTATCAAACAT
Shewanella woodyi ATCC 51908 Swoo_3036 -86 4.4 GTATATGACCCAGTTCACATTT
Position: -160
Score: 4.6
Sequence: AAGTGTGATCTGATTCTAACTT
Locus tag: Shewmr4_1406
Shewmr4_1406 -160 4.6 AAGTGTGATCTGATTCTAACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3090
Ortholog function: MoxR-like ATPase in aerotolerance operon
Shewanella oneidensis MR-1 SO3090 -165 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella putrefaciens CN-32 Sputcn32_2461 -97 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella sp W3-18-1 Sputw3181_1547 -97 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella sp ANA-3 Shewana3_1459 -160 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella sp MR-4 Shewmr4_1406 -160 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella sp MR-7 Shewmr7_1471 -160 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella baltica OS155 Sbal_2762 -148 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella denitrificans OS217 Sden_1528 -157 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella frigidimarina NCIMB 400 Sfri_2678 -167 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella amazonensis SB2B Sama_2169 -137 4.2 AAGTGTGACCCGATTCTAACTT
Shewanella loihica PV-4 Shew_2427 -296 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella pealeana ATCC 700345 Spea_2600 -306 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella halifaxensis HAW-EB4 Shal_2672 -319 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella piezotolerans WP3 swp_3141 -97 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella sediminis HAW-EB3 Ssed_1627 -316 4.6 AAGTGTGATCTGATTCTAACTT
Shewanella woodyi ATCC 51908 Swoo_3028 -306 4.8 AAATGTGATCTGATTCTAACTT
Position: -135
Score: 3.9
Sequence: AAGTTAGAATCAGATCACACTT
Locus tag: Shewmr4_1407
Shewmr4_1407 -135 3.9 AAGTTAGAATCAGATCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadI
Ortholog function: 3-ketoacyl-CoA thiolase (EC 2.3.1.16)
Shewanella oneidensis MR-1 SO3089 -131 3.9 AAGTTAGAATCAGATCACACTT
Shewanella putrefaciens CN-32 Sputcn32_2460 -136 3.9 AAGTTAGAATCAGATCACACTT
Shewanella sp W3-18-1 Sputw3181_1548 -136 3.9 AAGTTAGAATCAGATCACACTT
Shewanella sp ANA-3 Shewana3_1460 -135 3.9 AAGTTAGAATCAGATCACACTT
Shewanella sp MR-4 Shewmr4_1407 -135 3.9 AAGTTAGAATCAGATCACACTT
Shewanella sp MR-7 Shewmr7_1472 -135 3.9 AAGTTAGAATCAGATCACACTT
Shewanella baltica OS155 Sbal_2761 -136 3.9 AAGTTAGAATCAGATCACACTT
Shewanella denitrificans OS217 Sden_1529 -109 3.9 AAGTTAGAATCAGATCACACTT
Shewanella frigidimarina NCIMB 400 Sfri_2677 -104 3.9 AAGTTAGAATCAGATCACACTT
Shewanella amazonensis SB2B Sama_2168 -112 3.6 AAGTTAGAATCGGGTCACACTT
Shewanella loihica PV-4 Shew_2426 -134 3.9 AAGTTAGAATCAGATCACACTT
Shewanella pealeana ATCC 700345 Spea_2599 -116 3.9 AAGTTAGAATCAGATCACACTT
Shewanella halifaxensis HAW-EB4 Shal_2671 -119 3.9 AAGTTAGAATCAGATCACACTT
Shewanella piezotolerans WP3 swp_3140 -122 3.9 AAGTTAGAATCAGATCACACTT
Shewanella sediminis HAW-EB3 Ssed_1628 -151 3.9 AAGTTAGAATCAGATCACACTT
Shewanella woodyi ATCC 51908 Swoo_3027 -138 4.1 AAGTTAGAATCAGATCACATTT
Position: -105
Score: 3.9
Sequence: CCGTGTGAGGTATTTCGCAAAT
Locus tag: Shewmr4_1513
Shewmr4_1513 -105 3.9 CCGTGTGAGGTATTTCGCAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2858
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO2858 -105 4.8 TATTGTGAGTAAGTTCGCAAAT
Shewanella putrefaciens CN-32 Sputcn32_2359 -75 4.2 AGTCGTGATTGTGCTCACACCA
Shewanella sp W3-18-1 Sputw3181_1650 -75 4.2 AGTCGTGATTGTGCTCACACCA
Shewanella sp ANA-3 Shewana3_1574 -105 4 GGATGTGAGCCGCTTCGCAAAT
Shewanella sp MR-4 Shewmr4_1513 -105 3.9 CCGTGTGAGGTATTTCGCAAAT
Shewanella sp MR-7 Shewmr7_1580 -105 3.9 CCGTGTGAGGTATTTCGCAAAT
Shewanella baltica OS155 Sbal_2639 -75 4.2 AGTCGTGATTGTGCTCACACCA
Shewanella frigidimarina NCIMB 400 Sfri_1546 -237 4.9 TTTTGTGATGCAGATCTCAATC
Position: -36
Score: 4.1
Sequence: TAGTGGGATAAAATTCACCTAA
Locus tag: Shewmr4_1515
Shewmr4_1515 -36 4.1 TAGTGGGATAAAATTCACCTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2856
Ortholog function: predicted signal-transduction protein containing cAMP-binding and CBS domains
Shewanella oneidensis MR-1 SO2856 -105 4.8 TATTGTGAGTAAGTTCGCAAAT
Shewanella putrefaciens CN-32 Sputcn32_2357 -75 4.2 AGTCGTGATTGTGCTCACACCA
Shewanella sp W3-18-1 Sputw3181_1652 -75 4.2 AGTCGTGATTGTGCTCACACCA
Shewanella sp ANA-3 Shewana3_1576 -105 4 GGATGTGAGCCGCTTCGCAAAT
Shewanella sp MR-4 Shewmr4_1515 -105 3.9 CCGTGTGAGGTATTTCGCAAAT
Shewanella sp MR-7 Shewmr7_1582 -105 3.9 CCGTGTGAGGTATTTCGCAAAT
Shewanella baltica OS155 Sbal_2637 -75 4.2 AGTCGTGATTGTGCTCACACCA
Shewanella frigidimarina NCIMB 400 Sfri_1548 -237 4.9 TTTTGTGATGCAGATCTCAATC
Position: -103
Score: 4.8
Sequence: TTAGGTGATCTTTGTCACAAAT
Locus tag: Shewmr4_1561
Shewmr4_1561 -103 4.8 TTAGGTGATCTTTGTCACAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yceI
Ortholog function: hypothetical protein
Shewanella putrefaciens CN-32 Sputcn32_1651 -70 3.8 TAAATGGATGTAAATCACGATT
Shewanella sp W3-18-1 Sputw3181_2375 -70 3.8 TAAATGGATGTAAATCACGATT
Shewanella sp ANA-3 Shewana3_1628 -102 4.6 TTAGGTGATCTTTGTCACAGAT
Shewanella sp MR-4 Shewmr4_1561 -103 4.8 TTAGGTGATCTTTGTCACAAAT
Shewanella sp MR-7 Shewmr7_1636 -103 4.8 TTAGGTGATCTTTGTCACAAAT
Shewanella baltica OS155 Sbal_1772 -105 4.7 TTAGGTGATGTGGGTCACGTTT
Shewanella pealeana ATCC 700345 Spea_2476 -166 3.8 TTACGTGCTGAATTGCAAAATT
-69 3.8 AATTGTTACGCATCTTACGCTA
Shewanella piezotolerans WP3 swp_3020 -42 3.8 TACATTGATATCTATCACTATT
Position: -91
Score: 4.3
Sequence: AACAATGATTCACATCACAAAT
Locus tag: Shewmr4_1572
Shewmr4_1572 -91 4.3 AACAATGATTCACATCACAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: sodB
Ortholog function: superoxide dismutase [Fe] (EC 1.15.1.1)
Shewanella oneidensis MR-1 SO2881 -91 4.3 AACAATGATTCACATCACAAAT
Shewanella putrefaciens CN-32 Sputcn32_1687 -91 4.3 AACAATGATTCACATCACAAAT
Shewanella sp W3-18-1 Sputw3181_2338 -91 4.3 AACAATGATTCACATCACAAAT
Shewanella sp ANA-3 Shewana3_1639 -91 4.3 AACAATGATTCACATCACAAAT
Shewanella sp MR-4 Shewmr4_1572 -91 4.3 AACAATGATTCACATCACAAAT
Shewanella sp MR-7 Shewmr7_1647 -91 4.3 AACAATGATTCACATCACAAAT
Shewanella baltica OS155 Sbal_1782 -90 4.3 AACAATGATTCACATCACAAAT
Shewanella denitrificans OS217 Sden_1639 -106 4.3 AACAATGATGCACATCACAAAA
Shewanella frigidimarina NCIMB 400 Sfri_1747 -102 4.2 AACAATGATTCACATCACAAAA
Shewanella amazonensis SB2B Sama_1920 -91 4.2 AAGAATGATTCACATCACAGAT
Shewanella loihica PV-4 Shew_1834 -89 3.8 AACAATGATTCACATCACAACT
Shewanella halifaxensis HAW-EB4 Shal_2336 -93 3.7 AACAATGATACACTTCACAACT
Position: -157
Score: 4.5
Sequence: ATTTGTGATGTGAATCATTGTT
Locus tag: Shewmr4_1573
Shewmr4_1573 -157 4.5 ATTTGTGATGTGAATCATTGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ydhD
Ortholog function: Probable monothiol glutaredoxin ydhD
Shewanella oneidensis MR-1 SO2880 -157 4.5 ATTTGTGATGTGAATCATTGTT
Shewanella putrefaciens CN-32 Sputcn32_1688 -156 4.5 ATTTGTGATGTGAATCATTGTT
Shewanella sp W3-18-1 Sputw3181_2337 -156 4.5 ATTTGTGATGTGAATCATTGTT
Shewanella sp ANA-3 Shewana3_1640 -157 4.5 ATTTGTGATGTGAATCATTGTT
Shewanella sp MR-4 Shewmr4_1573 -157 4.5 ATTTGTGATGTGAATCATTGTT
Shewanella sp MR-7 Shewmr7_1648 -157 4.5 ATTTGTGATGTGAATCATTGTT
Shewanella baltica OS155 Sbal_1783 -156 4.5 ATTTGTGATGTGAATCATTGTT
Shewanella denitrificans OS217 Sden_1640 -137 4.5 TTTTGTGATGTGCATCATTGTT
Shewanella frigidimarina NCIMB 400 Sfri_1748 -155 4.5 TTTTGTGATGTGAATCATTGTT
Shewanella amazonensis SB2B Sama_1919 -173 4.2 ATCTGTGATGTGAATCATTCTT
Shewanella loihica PV-4 Shew_1835 -164 4.2 AGTTGTGATGTGAATCATTGTT
Shewanella pealeana ATCC 700345 Spea_1964 -154 3.6 ACTTGTGAAGTGTATCATTGTT
Shewanella halifaxensis HAW-EB4 Shal_2335 -154 3.9 AGTTGTGAAGTGTATCATTGTT
Shewanella piezotolerans WP3 swp_2753 -153 3.6 ACTTGTGAAGTGTATCATTGTT
Position: -208
Score: 3.9
Sequence: AAATGTGATCTACGCCTAAATG
Locus tag: Shewmr4_1606
Shewmr4_1606 -208 3.9 AAATGTGATCTACGCCTAAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: icd
Ortholog function: isocitrate dehydrogenase [NADP] (EC 1.1.1.42); monomeric isocitrate dehydrogenase [NADP] (EC 1.1.1.42)
Shewanella oneidensis MR-1 SO2629 -199 4.1 AAATGTGATCTACACCTAAATG
Shewanella putrefaciens CN-32 Sputcn32_2230 -212 3.9 AAATGTGATCTGTGCCTAAATG
Shewanella sp W3-18-1 Sputw3181_1779 -212 3.9 AAATGTGATCTGTGCCTAAATG
Shewanella sp ANA-3 Shewana3_1750 -209 3.9 AAATGTGATCTACGCCTAAATG
Shewanella sp MR-4 Shewmr4_1606 -208 3.9 AAATGTGATCTACGCCTAAATG
Shewanella sp MR-7 Shewmr7_1681 -208 3.9 AAATGTGATCTACGCCTAAATG
Shewanella baltica OS155 Sbal_2475 -212 3.9 AAATGTGATCTGTGCCTAAATG
Shewanella frigidimarina NCIMB 400 Sfri_2257 -242 4.6 AATTGTGATCTGTACCTAATTT
Shewanella loihica PV-4 Shew_1563 -237 3.8 ATTTATGATGTCGGCCAACTAA
-217 4.1 AAATGTGATCGATAGCAAAACG
Shewanella pealeana ATCC 700345 Spea_2535 -195 4.2 AAGTGTGATCTGCAGCTAACTA
Shewanella piezotolerans WP3 swp_1868 -21 4.2 AAGTGTGATCCGCAACTAAATT
Shewanella sediminis HAW-EB3 Ssed_1883 -275 3.9 AAGTGTGATCTGCGCCAAGTTG
Shewanella woodyi ATCC 51908 Swoo_2702 -304 3.9 AAGTGTGATCTAAGCCAAGTTG
Position: -63
Score: 3.8
Sequence: TATTTTGATATTGAATAAAATA
Position: -34
Score: 3.8
Sequence: TGATGTGCCAGTGTTCAAATAG
Position: -2
Score: 4
Sequence: TTATGTTATTATTGCCACAAAA
Locus tag: Shewmr4_1682
Shewmr4_1682 -63 3.8 TATTTTGATATTGAATAAAATA
-34 3.8 TGATGTGCCAGTGTTCAAATAG
-2 4 TTATGTTATTATTGCCACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ycbW
Ortholog function: probable membrane protein YcbW
Shewanella oneidensis MR-1 SO2591 -63 3.8 TATTTTGATATTGAATAAAATA
-34 3.8 TGATGTGCCAGTGTTCAAATAG
-2 3.7 TTATGTTATTATTGCCGCAAAA
Shewanella putrefaciens CN-32 Sputcn32_2193 -63 3.8 TATTTTGATATTGAATAAAATA
-34 4 TTATGTGCGAGTGTTCAAATAG
-2 3.8 TTATGTTATTAATGCCGCAAAA
Shewanella sp W3-18-1 Sputw3181_1816 -63 3.8 TATTTTGATATTGAATAAAATA
-34 3.7 TGATGTGCGAGTGTTCAAATAG
-2 3.8 TTATGTTATTAATGCCGCAAAA
Shewanella sp ANA-3 Shewana3_1787 -63 3.8 TATTTTGATATTGAATAAAATA
-34 3.7 TGATGTGCGAGTGTTCAAATAG
-2 4 TTATGTTATTATTGCCACAAAA
Shewanella sp MR-4 Shewmr4_1682 -63 3.8 TATTTTGATATTGAATAAAATA
-34 3.8 TGATGTGCCAGTGTTCAAATAG
-2 4 TTATGTTATTATTGCCACAAAA
Shewanella sp MR-7 Shewmr7_1757 -63 3.8 TATTTTGATATTGAATAAAATA
-34 3.7 TGATGTGCGAGTGTTCAAATAG
-2 4 TTATGTTATTATTGCCACAAAA
Shewanella baltica OS155 Sbal_2438 -2 4.2 TTATGTTATTAATGCCACAAAA
Shewanella denitrificans OS217 Sden_1731 -139 4.2 ATTTATGAGTGCGATCAAAATT
Shewanella amazonensis SB2B Sama_1594 -2 3.9 TTATGTTATTAATGCCACATAC
Shewanella loihica PV-4 Shew_1811 -94 4.6 TGTTGTAATCTATATCATATTT
Shewanella pealeana ATCC 700345 Spea_1944 -62 4.1 TATTTTGATATTGATGAAATTA
Shewanella halifaxensis HAW-EB4 Shal_2355 -62 4.1 TATTTTGATATTGATGAAATAA
Shewanella piezotolerans WP3 swp_2809 -239 3.8 TTTAATAATATAGATCATAAAA
-143 4.1 TATTTTGATATTGATGAAATTA
-2 4 ATATGGAATTTCTATCACCTTT
Shewanella sediminis HAW-EB3 Ssed_2474 -94 4.6 TATTGTTATTCAACTCATATTT
Shewanella woodyi ATCC 51908 Swoo_2142 -52 4 TACTTTGATATTGAACAAAATA
Position: -166
Score: 3.9
Sequence: AAATTAGATCTGCATCATGTTA
Position: -106
Score: 4.2
Sequence: ATTCTTGATATGCATCAAGAAT
Locus tag: Shewmr4_1822
Shewmr4_1822 -166 3.9 AAATTAGATCTGCATCATGTTA
-106 4.2 ATTCTTGATATGCATCAAGAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hyaA
Ortholog function: Quinone-reactive Ni/Fe-hydrogenase small chain precursor (EC 1.12.5.1)
Shewanella oneidensis MR-1 SO2099 -105 4 ATTCTTGATATGCATCAATAAT
Shewanella putrefaciens CN-32 Sputcn32_2088 -167 3.7 AAATTAGATCTGCGTCATGTTA
-107 4 ATTCTTGATATACATCAATAAT
Shewanella sp W3-18-1 Sputw3181_1924 -167 3.7 AAATTAGATCTGCGTCATGTTA
-107 4 ATTCTTGATATACATCAATAAT
Shewanella sp ANA-3 Shewana3_1880 -166 3.9 AAATTAGATCTGCATCATGTTA
-106 4.2 ATTCTTGATATGCATCAAGAAT
Shewanella sp MR-4 Shewmr4_1822 -166 3.9 AAATTAGATCTGCATCATGTTA
-106 4.2 ATTCTTGATATGCATCAAGAAT
Shewanella sp MR-7 Shewmr7_2155 -166 3.9 AAATTAGATCTGCATCATGTTA
-106 4.2 ATTCTTGATATGCATCAAGAAT
Shewanella baltica OS155 Sbal_1889 -229 3.9 TTAAGTGACCGATTTCATCCAA
-167 3.7 AAATTAGATCTACGTCATGTTA
-107 4.2 ATTCTTGATATACATCAAGAAT
Shewanella frigidimarina NCIMB 400 Sfri_2103 -174 3.8 TTTTGTTAACTTGATCAACATC
-168 4.4 TAACTTGATCAACATCATAAAT
Shewanella amazonensis SB2B Sama_1679 -172 3.4 AAGCATGACACACCTCATGTTA
Shewanella loihica PV-4 Shew_1765 -164 3.8 AAACTTGATCCAGCTCATAGCT
-103 3.7 AATGTTGACATACATCAACATT
Shewanella pealeana ATCC 700345 Spea_2033 -211 4.6 TTACGTGACCACGATCACCTTT
Shewanella halifaxensis HAW-EB4 Shal_2261 -212 5 TTACGTGATCTCCATCACCTTT
Shewanella sediminis HAW-EB3 Ssed_1908 -162 4 AAAGATGATCTAGTTCATATTG
Position: -266
Score: 4.2
Sequence: ATTCTTGATGCATATCAAGAAT
Position: -206
Score: 4.2
Sequence: TAACATGATGCAGATCTAATTT
Locus tag: Shewmr4_1823
Shewmr4_1823 -266 4.2 ATTCTTGATGCATATCAAGAAT
-206 4.2 TAACATGATGCAGATCTAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: resA
Ortholog function: C-type cytochrome biogenesis protein ResA (thioredoxin)
Shewanella oneidensis MR-1 SO2100 -265 4.1 ATTATTGATGCATATCAAGAAT
Shewanella putrefaciens CN-32 Sputcn32_2087 -279 4.2 ATTATTGATGTATATCAAGAAT
-219 3.9 TAACATGACGCAGATCTAATTT
Shewanella sp W3-18-1 Sputw3181_1925 -279 4.2 ATTATTGATGTATATCAAGAAT
-219 3.9 TAACATGACGCAGATCTAATTT
Shewanella sp ANA-3 Shewana3_1881 -251 4.2 ATTCTTGATGCATATCAAGAAT
-191 4.2 TAACATGATGCAGATCTAATTT
Shewanella sp MR-4 Shewmr4_1823 -266 4.2 ATTCTTGATGCATATCAAGAAT
-206 4.2 TAACATGATGCAGATCTAATTT
Shewanella sp MR-7 Shewmr7_2154 -251 4.2 ATTCTTGATGCATATCAAGAAT
-191 4.2 TAACATGATGCAGATCTAATTT
Shewanella baltica OS155 Sbal_1890 -301 4.3 ATTCTTGATGTATATCAAGAAT
-241 4 TAACATGACGTAGATCTAATTT
Shewanella woodyi ATCC 51908 Swoo_2219 -140 4.1 ATTTTTGATGCTAATCAAATGA
Position: -100
Score: 3.9
Sequence: GTCTTTGATCTGAATCAAAAAA
Position: -79
Score: 4.3
Sequence: ACACGCGATCTTGATCACACTT
Locus tag: Shewmr4_1833
Shewmr4_1833 -100 3.9 GTCTTTGATCTGAATCAAAAAA
-79 4.3 ACACGCGATCTTGATCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2111
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO2111 -79 4.8 ACACGTGATCTTGATCACACTT
Shewanella putrefaciens CN-32 Sputcn32_1894 -66 4.5 ACACGAGATCTAGATCACATTT
Shewanella sp W3-18-1 Sputw3181_2114 -66 4.5 ACACGAGATCTAGATCACATTT
Shewanella sp ANA-3 Shewana3_1891 -79 3.9 ACCCGCGATCTTGATCACACTT
Shewanella sp MR-4 Shewmr4_1833 -100 3.9 GTCTTTGATCTGAATCAAAAAA
-79 4.3 ACACGCGATCTTGATCACACTT
Shewanella sp MR-7 Shewmr7_2144 -100 3.9 GTCTTTGATCTGAATCAAAAAA
-79 4.3 ACACGCGATCTTGATCACACTT
Shewanella baltica OS155 Sbal_1900 -78 4 ACACGCGATCTAGATCACACTG
Position: -255
Score: 4.1
Sequence: AAGTGTGATCAAGATCGCGTGT
Position: -234
Score: 4.3
Sequence: TTTTTTGATTCAGATCAAAGAC
Locus tag: Shewmr4_1834
Shewmr4_1834 -255 4.1 AAGTGTGATCAAGATCGCGTGT
-234 4.3 TTTTTTGATTCAGATCAAAGAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: rplY
Ortholog function: LSU ribosomal protein L25p
Shewanella oneidensis MR-1 SO2112 -95 4.4 AAGTGTGATCAAGATCACGTGT
Shewanella putrefaciens CN-32 Sputcn32_1895 -245 4.4 AAATGTGATCTAGATCTCGTGT
Shewanella sp W3-18-1 Sputw3181_2113 -245 4.4 AAATGTGATCTAGATCTCGTGT
Shewanella sp ANA-3 Shewana3_1892 -234 3.8 TTTTTTGATTCAGATCAAAGCC
Shewanella sp MR-4 Shewmr4_1834 -255 4.1 AAGTGTGATCAAGATCGCGTGT
-234 4.3 TTTTTTGATTCAGATCAAAGAC
Shewanella sp MR-7 Shewmr7_2143 -255 4.1 AAGTGTGATCAAGATCGCGTGT
-234 4.3 TTTTTTGATTCAGATCAAAGAC
Shewanella baltica OS155 Sbal_1901 -247 4 CAGTGTGATCTAGATCGCGTGT
Shewanella amazonensis SB2B Sama_1614 -233 3.9 AAATGTGAACAAGATCACAGGC
Position: -319
Score: 5.6
Sequence: AAATGTGATGTGCGTCACATTT
Locus tag: Shewmr4_1903
Shewmr4_1903 -319 5.6 AAATGTGATGTGCGTCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2427
Ortholog function: TonB-dependent receptor
Shewanella oneidensis MR-1 SO2427 -319 5.1 AAGTGTGATTAAAATCACACTT
Shewanella putrefaciens CN-32 Sputcn32_1940 -318 5.7 TAGTGTGATCTACATCACATAA
-274 4 AAATGTTATTTTATTAACAGAG
Shewanella sp W3-18-1 Sputw3181_2068 -318 4.6 GCGTGTGATCTATATCACATAA
Shewanella sp ANA-3 Shewana3_1958 -320 5.2 AAGTGTGACACACATCACATAT
-276 4.4 AAATGTTATTTTCTTAACAGTT
Shewanella sp MR-4 Shewmr4_1903 -319 5.6 AAATGTGATGTGCGTCACATTT
-275 3.9 AAATGTTATTTTATTAACAGCT
Shewanella sp MR-7 Shewmr7_2075 -319 5.2 AAGTGTGACGTGTGTCACATTT
-275 4.3 AAATGTTATTTTATTAACAGTA
Shewanella baltica OS155 Sbal_2044 -317 5.1 AAGCGTGATCTGTGTCACATTT
Shewanella frigidimarina NCIMB 400 Sfri_2416 -149 5 AAATGTGATGTTGTTCACATGT
-4 4.1 ATTCATGAGTTCAGTCACATTA
Shewanella amazonensis SB2B Sama_1838 -324 3.8 TTAATCGATATGGGTCACAGAA
-301 5.2 AAGTGTGATGCACGTCACAAAA
Shewanella loihica PV-4 Shew_2074 -308 5.1 TTTTGTGATAATGGTCACACTT
Shewanella halifaxensis HAW-EB4 Shal_1923 -306 5.5 AATTGTGATGCGCGTCACAATT
-199 4.1 ACTTGTGCTGTTTGTCACAATG
Shewanella piezotolerans WP3 swp_2362 -310 4.7 AAGCGTGACCTGTGTCACACTT
Shewanella sediminis HAW-EB3 Ssed_2036 -316 4.6 TTTCGTGACGCGCGTCACAGTT
Shewanella woodyi ATCC 51908 Swoo_2565 -321 4.9 TTCTGTGACCTGTGTCACAAAA
Position: -86
Score: 4.6
Sequence: TGCTTTGATTTACATCACAATT
Position: 16
Score: 3.7
Sequence: TTATGTTATTGTTTTTAAGTAT
Locus tag: Shewmr4_1948
Shewmr4_1948 -86 4.6 TGCTTTGATTTACATCACAATT
16 3.7 TTATGTTATTGTTTTTAAGTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Sama_2599
Ortholog function: putative lipoprotein
Shewanella sp MR-4 Shewmr4_1948 -86 4.6 TGCTTTGATTTACATCACAATT
Shewanella sp MR-7 Shewmr7_2028 -86 4.6 TGCTTTGATTTACATCACAATT
Shewanella frigidimarina NCIMB 400 Sfri_3610 -77 4 TTTGTTGATGTTGATCAAATTC
Shewanella amazonensis SB2B Sama_2599 -87 4.2 CTGCTTGATGAGGATCACAATT
Shewanella loihica PV-4 Shew_3086 -117 3.7 AAGCGTTAGCCCACTCACAAAG
Position: -171
Score: 4.3
Sequence: TTTTTTGACATGGCTCAAGTAT
Locus tag: Shewmr4_2006
Shewmr4_2006 -171 4.3 TTTTTTGACATGGCTCAAGTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ccoN
Ortholog function: Cbb3-type cytochrome c oxidase, subunit I, CcoN
Shewanella oneidensis MR-1 SO2364 -173 4.3 TTTTTTGACATGGCTCAAGTAT
-125 4.1 AAATGTGAAGGATAACGCATTG
Shewanella putrefaciens CN-32 Sputcn32_1959 -171 4.2 TTTTTTGACATTGCTCAAGTAT
Shewanella sp W3-18-1 Sputw3181_2046 -171 4.2 TTTTTTGACATTGCTCAAGTAT
Shewanella sp ANA-3 Shewana3_2107 -171 4.3 TTTTTTGACATGGCTCAAGTAT
Shewanella sp MR-4 Shewmr4_2006 -171 4.3 TTTTTTGACATGGCTCAAGTAT
Shewanella sp MR-7 Shewmr7_1969 -171 4.3 TTTTTTGACATGGCTCAAGTAT
Shewanella baltica OS155 Sbal_2201 -173 4.5 TTTTTTGATATTGCTCAAGTAT
Shewanella baltica OS155 Sbal_4487 -173 4.5 TTTTTTGATATTGCTCAAGTAT
Shewanella denitrificans OS217 Sden_1851 -182 4.7 TTTTTTGATGTAGCTCAAGTAT
Shewanella frigidimarina NCIMB 400 Sfri_2010 -186 4.4 TTTTTTGACTTAGCTCAAGTAT
Shewanella amazonensis SB2B Sama_1791 -180 4.3 TTTTTTGACACAGCTCAAGTAT
Shewanella loihica PV-4 Shew_1985 -178 4.5 TTTTTTGATATTGCTCAAGTAT
Shewanella pealeana ATCC 700345 Spea_2214 -219 4.1 TACCTTGATCTAGATCAACTTA
-176 4.6 TTTTTTGATATAGCTCAAGTAT
Shewanella halifaxensis HAW-EB4 Shal_2197 -221 4.5 AGATTTGATCTAGATCAACTTT
-178 4.6 TTTTTTGATATAGCTCAAGTAT
Shewanella piezotolerans WP3 swp_2572 -221 4.3 TAGCTTGATCTAGATCAACTTT
-178 4.4 TTTTTTGACATAGCTCAAGTAT
Shewanella sediminis HAW-EB3 Ssed_2211 -177 4.4 TTTTTTGACATAGCTCAAGTAT
Shewanella woodyi ATCC 51908 Swoo_2425 -220 4.3 TAGCTTGATCTAGATCAACTTT
-177 4.4 TTTTTTGACATAGCTCAAGTAT
Position: -205
Score: 4
Sequence: TTTTGTGAGCAAGAGCTAAATA
Position: -153
Score: 4.8
Sequence: CAAAGTGATACAGCTCACATTA
Locus tag: Shewmr4_2107
Shewmr4_2107 -205 4 TTTTGTGAGCAAGAGCTAAATA
-153 4.8 CAAAGTGATACAGCTCACATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: gloA
Ortholog function: lactoylglutathione lyase (EC 4.4.1.5)
Shewanella putrefaciens CN-32 Sputcn32_2101 -120 3.8 TTTTGTGAGCAACAACCAATTT
-4 3.8 ATTAATGATCTCGTTAACGCAA
Shewanella sp W3-18-1 Sputw3181_1911 -120 3.8 TTTTGTGAGCAACAACCAATTT
-4 3.8 ATTAATGATCTCGTTAACGCAA
Shewanella sp ANA-3 Shewana3_2232 -205 4 TTTTGTGAGCAAGAGCTAAATA
-153 4.4 CAAAGTGACGTAGCTCACAAAG
Shewanella sp MR-4 Shewmr4_2107 -205 4 TTTTGTGAGCAAGAGCTAAATA
-153 4.8 CAAAGTGATACAGCTCACATTA
Shewanella sp MR-7 Shewmr7_1867 -205 4 TTTTGTGAGCAAGAGCTAAATA
-153 4.8 CAAAGTGATACAGCTCACATTA
Shewanella baltica OS155 Sbal_2269 -196 4 TTTTGTGAGCGACAGCCAATTT
Shewanella baltica OS155 Sbal_4555 -196 4 TTTTGTGAGCGACAGCCAATTT
Shewanella frigidimarina NCIMB 400 Sfri_2179 -101 4.6 AAATGTGAACTAAAGCAAAATT
Shewanella frigidimarina NCIMB 400 Sfri_2098 -213 3.8 AAACGTTAAATCCATTACATTA
-41 3.7 TTTAATGATGCGATTCAGAGAT
Shewanella amazonensis SB2B Sama_1837 -96 4.3 AACTGTGAGTTGCTTCAGATTT
Shewanella halifaxensis HAW-EB4 Shal_1924 -95 4 TAAATTGATCTCGCTCAATTTT
Shewanella sediminis HAW-EB3 Ssed_2709 -312 3.8 TTTTGTAATTTTTTAAACAGTA
Shewanella woodyi ATCC 51908 Swoo_2563 -243 3.8 TTTTATGACTCTATTAATATAA
Position: -104
Score: 4.6
Sequence: AAATGTGATGTAGCCCAAAAAG
Locus tag: Shewmr4_2124
Shewmr4_2124 -104 4.6 AAATGTGATGTAGCCCAAAAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: fumB
Ortholog function: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
Shewanella oneidensis MR-1 SO2222 -105 4.6 AAATGTGATGTAGCCCAAAAAG
Shewanella putrefaciens CN-32 Sputcn32_1807 -103 4.6 AAATGTGATGTAGCCCAAAAAG
Shewanella sp W3-18-1 Sputw3181_2218 -103 4.6 AAATGTGATGTAGCCCAAAAAG
Shewanella sp ANA-3 Shewana3_2302 -104 4.6 AAATGTGATGTAGCCCAAAAAG
Shewanella sp MR-4 Shewmr4_2124 -104 4.6 AAATGTGATGTAGCCCAAAAAG
Shewanella sp MR-7 Shewmr7_2200 -104 4.6 AAATGTGATGTAGCCCAAAAAG
Shewanella baltica OS155 Sbal_1918 -103 4.6 AAATGTGATGTAGCCCAAAAAG
Shewanella denitrificans OS217 Sden_1912 -131 3.9 AAATGTGATGTAGCCCCAAAAG
Shewanella frigidimarina NCIMB 400 Sfri_2156 -122 4.6 AAATGTGATGTAGCCCAAAAAG
Shewanella amazonensis SB2B Sama_1688 -144 4.2 ACTTGTGATGTAGCCCAAAGAT
Shewanella loihica PV-4 Shew_1904 -111 3.9 AAATGTGATGTTCCCCTAAAAG
-73 4.8 TATTGTGAACGGATTCAAAAAA
Shewanella pealeana ATCC 700345 Spea_2038 -162 4.3 AAATGTGATGTTTAACTCAAAC
Shewanella halifaxensis HAW-EB4 Shal_2256 -162 4.3 AAATGTGATGTTTAACTCAAAC
Shewanella piezotolerans WP3 swp_2633 -162 4.4 AAATGTGATGTTTAACTCAAAG
Shewanella sediminis HAW-EB3 Ssed_2358 -194 3.8 AAATGTGATATTCCCCTAAAAG
Position: -193
Score: 4.4
Sequence: TTTGTTGATTGCGATCACAATT
Position: -163
Score: 3.8
Sequence: TGGTCTGACCTGTGTCGCATAA
Locus tag: Shewmr4_2145
Shewmr4_2145 -193 4.4 TTTGTTGATTGCGATCACAATT
-163 3.8 TGGTCTGACCTGTGTCGCATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2535
Ortholog function: Predicted glutamine amidotransferase
Shewanella oneidensis MR-1 SO2535 -194 4.4 TTTGTTGATTGCGATCACAATT
Shewanella putrefaciens CN-32 Sputcn32_1792 -193 4.7 TTTATTGATGGCGATCACAATT
Shewanella sp W3-18-1 Sputw3181_2233 -193 4.7 TTTATTGATGGCGATCACAATT
Shewanella sp ANA-3 Shewana3_2322 -133 4.4 TTTGTTGATTGCGATCACAATT
Shewanella sp MR-4 Shewmr4_2145 -193 4.4 TTTGTTGATTGCGATCACAATT
Shewanella sp MR-7 Shewmr7_2222 -193 4.4 TTTGTTGATTGCGATCACAATT
Shewanella baltica OS155 Sbal_2305 -193 4.4 TTTGTTGATTGCGATCACAATT
Shewanella denitrificans OS217 Sden_1765 -204 3.7 TATGATGATCCTATTCACAAGT
Shewanella frigidimarina NCIMB 400 Sfri_1870 -203 3.9 ATTATTGATCTCATTCACAAGA
Shewanella amazonensis SB2B Sama_1869 -195 3.9 ATAAGCGATCCTGATCACAAGT
Shewanella loihica PV-4 Shew_2107 -191 4.6 TTATATGACCATAATCACAATT
Shewanella pealeana ATCC 700345 Spea_2392 -196 4.4 TTTTGAGTTCTATCTCACAATT
Shewanella halifaxensis HAW-EB4 Shal_1891 -199 4.2 TTTTGAGGTTTATCTCACAATT
Shewanella sediminis HAW-EB3 Ssed_2000 -191 4.5 TTTATTGATCATAATCACAATT
Shewanella woodyi ATCC 51908 Swoo_2603 -190 4.8 TATATTGATCGATATCACAATT
Position: -102
Score: 3.4
Sequence: TTATGCGACACAGGTCAGACCA
Position: -72
Score: 4.8
Sequence: AATTGTGATCGCAATCAACAAA
Locus tag: Shewmr4_2146
Shewmr4_2146 -102 3.4 TTATGCGACACAGGTCAGACCA
-72 4.8 AATTGTGATCGCAATCAACAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadE2
Ortholog function: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Shewanella oneidensis MR-1 SO2536 -72 4.8 AATTGTGATCGCAATCAACAAA
Shewanella putrefaciens CN-32 Sputcn32_1791 -72 4.6 AATTGTGATCGCCATCAATAAA
Shewanella sp W3-18-1 Sputw3181_2234 -72 4.6 AATTGTGATCGCCATCAATAAA
Shewanella sp ANA-3 Shewana3_2323 -72 4.8 AATTGTGATCGCAATCAACAAA
Shewanella sp MR-4 Shewmr4_2146 -72 4.8 AATTGTGATCGCAATCAACAAA
Shewanella sp MR-7 Shewmr7_2223 -72 4.8 AATTGTGATCGCAATCAACAAA
Shewanella baltica OS155 Sbal_2306 -72 4.8 AATTGTGATCGCAATCAACAAA
Shewanella denitrificans OS217 Sden_1764 -66 3.8 ACTTGTGAATAGGATCATCATA
Shewanella frigidimarina NCIMB 400 Sfri_1869 -67 3.8 TCTTGTGAATGAGATCAATAAT
Shewanella amazonensis SB2B Sama_1870 -64 4.3 ACTTGTGATCAGGATCGCTTAT
Shewanella loihica PV-4 Shew_2108 -71 4.9 AATTGTGATTATGGTCATATAA
Shewanella pealeana ATCC 700345 Spea_2393 -70 4.5 AATTGTGAGATAGAACTCAAAA
Shewanella halifaxensis HAW-EB4 Shal_1890 -70 4.3 AATTGTGAGATAAACCTCAAAA
Shewanella piezotolerans WP3 swp_2312 -97 3.5 AATTGTGACGTAGACCCGCAAA
Shewanella sediminis HAW-EB3 Ssed_1999 -71 4.5 AATTGTGATTATGATCAATAAA
Shewanella woodyi ATCC 51908 Swoo_2604 -73 4.8 AATTGTGATATCGATCAATATA
Position: -155
Score: 5.1
Sequence: TTATGTGATGATGATCAAAATT
Locus tag: Shewmr4_2177
Shewmr4_2177 -155 5.1 TTATGTGATGATGATCAAAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fadD1
Ortholog function: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Shewanella oneidensis MR-1 SO2581 -155 5.1 TTATGTGATGATGATCAAAATT
Shewanella putrefaciens CN-32 Sputcn32_1761 -154 5.1 TTATGTGATGATGATCAAAATT
Shewanella sp W3-18-1 Sputw3181_2264 -154 5.1 TTATGTGATGATGATCAAAATT
Shewanella sp ANA-3 Shewana3_2386 -155 5.1 TTATGTGATGATGATCAAAATT
Shewanella sp MR-4 Shewmr4_2177 -155 5.1 TTATGTGATGATGATCAAAATT
Shewanella sp MR-7 Shewmr7_2254 -155 5.1 TTATGTGATGATGATCAAAATT
Shewanella baltica OS155 Sbal_1864 -156 5.1 TTATGTGATGATGATCAAAATT
Shewanella denitrificans OS217 Sden_1625 -189 4.1 TTATGTGATTATGGGCCCAAAT
Shewanella frigidimarina NCIMB 400 Sfri_1733 -165 4.7 TTATGTGATTATGATCGAAAAT
Shewanella amazonensis SB2B Sama_1934 -140 4.8 TTATGTGATGATTGTCAAAAAT
Shewanella loihica PV-4 Shew_2188 -149 4.9 TTGTGTGATGATGTTCAAAATT
Shewanella pealeana ATCC 700345 Spea_2448 -156 5 TTATGTGATGATAATCAAAATT
Shewanella halifaxensis HAW-EB4 Shal_1832 -155 5 TTATGTGATGATAATCAAAATT
Shewanella piezotolerans WP3 swp_2289 -153 5 ATATGTGATGATAATCAAAATT
Shewanella sediminis HAW-EB3 Ssed_2523 -151 5 TTATGTGATGATGATCATAATT
Shewanella woodyi ATCC 51908 Swoo_2110 -153 5.1 TTATGTGATGATGTTCAAAATT
Position: -177
Score: 4.2
Sequence: GTTAGTGATGGCGATCACAAAC
Locus tag: Shewmr4_2182
Shewmr4_2182 -177 4.2 GTTAGTGATGGCGATCACAAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2586
Ortholog function: inactive homolog of metal-dependent proteases, putative molecular chaperone
Shewanella oneidensis MR-1 SO2586 -177 4.1 GTTAGTGATAGCGATCACAAAC
Shewanella putrefaciens CN-32 Sputcn32_1756 -269 4.7 TTAAGTGACTTATATCACATTG
Shewanella sp W3-18-1 Sputw3181_2269 -269 4.7 TTAAGTGACTTATATCACATTG
Shewanella sp ANA-3 Shewana3_2391 -176 4.2 GTTAGTGATGGCGATCACAAAC
Shewanella sp MR-4 Shewmr4_2182 -177 4.2 GTTAGTGATGGCGATCACAAAC
Shewanella sp MR-7 Shewmr7_2259 -178 4.2 GTTAGTGATGGCGATCACAAAC
Shewanella baltica OS155 Sbal_1859 -205 4.3 ATCATTGACTTAGATCACATAA
Position: -217
Score: 4
Sequence: GTTTGTGATCGCCATCACTAAC
Locus tag: Shewmr4_2183
Shewmr4_2183 -217 4 GTTTGTGATCGCCATCACTAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: hemB-1
Ortholog function: porphobilinogen synthase (EC 4.2.1.24)
Shewanella oneidensis MR-1 SO2587 -197 4 GTTTGTGATCGCTATCACTAAC
Shewanella putrefaciens CN-32 Sputcn32_1755 -144 4.6 CAATGTGATATAAGTCACTTAA
Shewanella sp W3-18-1 Sputw3181_2270 -144 4.6 CAATGTGATATAAGTCACTTAA
Shewanella sp ANA-3 Shewana3_2392 -222 4 GTTTGTGATCGCCATCACTAAC
Shewanella sp MR-4 Shewmr4_2183 -217 4 GTTTGTGATCGCCATCACTAAC
Shewanella sp MR-7 Shewmr7_2260 -193 4 GTTTGTGATCGCCATCACTAAC
Shewanella baltica OS155 Sbal_1858 -168 4.4 TTATGTGATCTAAGTCAATGAT
Position: -65
Score: 4.9
Sequence: TTTTGTGATCTTAATCACTGTA
Locus tag: Shewmr4_2257
Shewmr4_2257 -65 4.9 TTTTGTGATCTTAATCACTGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2010
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO2010 -70 4.7 TTTTGTGATCTTCGTCACTGTA
Shewanella putrefaciens CN-32 Sputcn32_2305 -65 5.1 TTTTGTGATCTCCATCACCGTT
Shewanella sp W3-18-1 Sputw3181_1703 -65 5.1 TTTTGTGATCTCCATCACCGTT
Shewanella sp MR-4 Shewmr4_2257 -65 4.9 TTTTGTGATCTTAATCACTGTA
Shewanella sp MR-7 Shewmr7_2329 -65 4.9 TTTTGTGATCTTAATCACTGTA
Shewanella baltica OS155 Sbal_2577 -65 5 TTTTGTGATCTAAATCACTGTA
Shewanella denitrificans OS217 Sden_2384 -81 4.8 AAATGTGATCCAGCTCAGCTTT
Shewanella frigidimarina NCIMB 400 Sfri_2410 -116 4.8 TTTTGTGATCGACTTCACGTCT
Shewanella amazonensis SB2B Sama_1307 -51 4.3 TTTTGTGAGCTGCATCACGGCA
Shewanella loihica PV-4 Shew_2238 -48 4.1 AAAATTGATCTAGATCAATAAA
Shewanella pealeana ATCC 700345 Spea_1505 -51 4.1 AAAATTGATCTAGATCAATAAA
Shewanella halifaxensis HAW-EB4 Shal_1587 -80 4 TAGTGTGATTGATATCTATAAT
Shewanella piezotolerans WP3 swp_1711 -21 4.1 AAAATTGATCTAGATCAATAAA
Shewanella sediminis HAW-EB3 Ssed_2855 -49 4.1 AAAATTGATCTAGATCAATAAA
Shewanella woodyi ATCC 51908 Swoo_1790 -48 4.1 TAAATTGATCTAGATCAATAAA
Position: -148
Score: 4.6
Sequence: TAGTGTGATCTTCTTATCAATT
Locus tag: Shewmr4_2290
Shewmr4_2290 -148 4.6 TAGTGTGATCTTCTTATCAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hmgR
Ortholog function: Tyrosine degradation transcriptional regulator, LysR family
Shewanella oneidensis MR-1 SO1965 -148 4.4 TACTGTGATCTTCTTATCAATT
Shewanella putrefaciens CN-32 Sputcn32_1672 -148 4.8 TTATGTGATCTTGTTATCAATT
Shewanella sp W3-18-1 Sputw3181_2353 -148 4.8 TTATGTGATCTTGTTATCAATT
Shewanella sp ANA-3 Shewana3_2480 -148 4.6 TAGTGTGATCTTCTTATCAATT
-92 3.9 ATCTGTTATCTCAATCTAAAAA
Shewanella sp MR-4 Shewmr4_2290 -148 4.6 TAGTGTGATCTTCTTATCAATT
-92 3.9 ATCTGTTATCTCAATCTAAAAA
Shewanella sp MR-7 Shewmr7_2362 -148 4.6 TAGTGTGATCTTCTTATCAATT
-92 3.9 ATCTGTTATCTCTATCTAAAAA
Shewanella baltica OS155 Sbal_2614 -148 4.7 TAGTGTGATCTTGTTATCAATT
Shewanella denitrificans OS217 Sden_2161 -146 4.3 CGTTGTGATCTAGCTATCAATT
Shewanella frigidimarina NCIMB 400 Sfri_2325 -135 5.1 ATATGTGATCTAACTTACAATT
Shewanella amazonensis SB2B Sama_1570 -135 4.7 ATATGTGATCTGGGTATCAATT
Shewanella loihica PV-4 Shew_2153 -115 5.1 TTATGTGATCTAAGTAACAATT
Shewanella pealeana ATCC 700345 Spea_1875 -114 4.3 TAATGTGATCTAGGTTCAATTT
Shewanella halifaxensis HAW-EB4 Shal_2408 -114 4.5 TAATGTGATCTAGCTTTAATTT
Shewanella piezotolerans WP3 swp_2869 -115 4.9 TAATGTGATCTTGTTATCAATT
Shewanella sediminis HAW-EB3 Ssed_2686 -116 4.5 ATTTGTGACATACCTATCAATT
Shewanella woodyi ATCC 51908 Swoo_1933 -116 4.5 ATGTGTGATCTAAGTATCAATT
Position: -144
Score: 3.9
Sequence: TTTTTAGATTGAGATAACAGAT
Position: -88
Score: 3.9
Sequence: AATTGATAAGAAGATCACACTA
Locus tag: Shewmr4_2291
Shewmr4_2291 -144 3.9 TTTTTAGATTGAGATAACAGAT
-88 3.9 AATTGATAAGAAGATCACACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: hmgA
Ortholog function: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Shewanella oneidensis MR-1 SO1963 -92 3.8 AATTGATAAGAAGATCACAGTA
Shewanella putrefaciens CN-32 Sputcn32_1671 -66 4.1 AATTGATAACAAGATCACATAA
Shewanella sp W3-18-1 Sputw3181_2354 -66 4.1 AATTGATAACAAGATCACATAA
Shewanella sp ANA-3 Shewana3_2481 -144 3.9 TTTTTAGATTGAGATAACAGAT
-88 3.9 AATTGATAAGAAGATCACACTA
Shewanella sp MR-4 Shewmr4_2291 -144 3.9 TTTTTAGATTGAGATAACAGAT
-88 3.9 AATTGATAAGAAGATCACACTA
Shewanella sp MR-7 Shewmr7_2363 -144 3.9 TTTTTAGATAGAGATAACAGAT
-88 3.9 AATTGATAAGAAGATCACACTA
Shewanella baltica OS155 Sbal_2615 -144 3.5 TTTTTAGATTGAGATAACGGAT
-88 4 AATTGATAACAAGATCACACTA
Shewanella denitrificans OS217 Sden_2162 -122 3.6 AATTGATAGCTAGATCACAACG
Shewanella frigidimarina NCIMB 400 Sfri_2326 -126 3.5 TTTGTTGATCTTTACCACTAAA
-106 5 AATTGTAAGTTAGATCACATAT
Shewanella amazonensis SB2B Sama_1569 -78 4.5 AATTGATACCCAGATCACATAT
Shewanella loihica PV-4 Shew_2154 -61 5.1 AATTGTTACTTAGATCACATAA
Shewanella pealeana ATCC 700345 Spea_1874 -63 4 AAATTGAACCTAGATCACATTA
Shewanella halifaxensis HAW-EB4 Shal_2409 -63 3.9 AAATTAAAGCTAGATCACATTA
Shewanella piezotolerans WP3 swp_2870 -84 3.5 TTTTTTGCTGTTGTTAGCAACT
-61 4.1 AATTGATAACAAGATCACATTA
Position: -256
Score: 3.5
Sequence: AAAGATGAAACATCTCTCAATA
Locus tag: Shewmr4_2317
Shewmr4_2317 -256 3.5 AAAGATGAAACATCTCTCAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: hydC
Ortholog function: Ni,Fe-hydrogenase I cytochrome b subunit
Shewanella oneidensis MR-1 SO2097 -105 4 ATTCTTGATATGCATCAATAAT
Shewanella putrefaciens CN-32 Sputcn32_2090 -167 3.7 AAATTAGATCTGCGTCATGTTA
-107 4 ATTCTTGATATACATCAATAAT
Shewanella sp W3-18-1 Sputw3181_1922 -167 3.7 AAATTAGATCTGCGTCATGTTA
-107 4 ATTCTTGATATACATCAATAAT
Shewanella sp ANA-3 Shewana3_1878 -166 3.9 AAATTAGATCTGCATCATGTTA
-106 4.2 ATTCTTGATATGCATCAAGAAT
Shewanella sp MR-4 Shewmr4_1820 -166 3.9 AAATTAGATCTGCATCATGTTA
-106 4.2 ATTCTTGATATGCATCAAGAAT
Shewanella sp MR-7 Shewmr7_2157 -166 3.9 AAATTAGATCTGCATCATGTTA
-106 4.2 ATTCTTGATATGCATCAAGAAT
Shewanella baltica OS155 Sbal_1887 -229 3.9 TTAAGTGACCGATTTCATCCAA
-167 3.7 AAATTAGATCTACGTCATGTTA
-107 4.2 ATTCTTGATATACATCAAGAAT
Shewanella frigidimarina NCIMB 400 Sfri_2105 -174 3.8 TTTTGTTAACTTGATCAACATC
-168 4.4 TAACTTGATCAACATCATAAAT
Shewanella amazonensis SB2B Sama_1677 -172 3.4 AAGCATGACACACCTCATGTTA
Shewanella loihica PV-4 Shew_1763 -164 3.8 AAACTTGATCCAGCTCATAGCT
-103 3.7 AATGTTGACATACATCAACATT
Shewanella pealeana ATCC 700345 Spea_2031 -211 4.6 TTACGTGACCACGATCACCTTT
Shewanella halifaxensis HAW-EB4 Shal_2263 -212 5 TTACGTGATCTCCATCACCTTT
Shewanella sediminis HAW-EB3 Ssed_1906 -162 4 AAAGATGATCTAGTTCATATTG
Position: -184
Score: 4.4
Sequence: TTACATGATGCAGCGCACATTT
Locus tag: Shewmr4_2318
Shewmr4_2318 -184 4.4 TTACATGATGCAGCGCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cctA
Ortholog function: cytochrome c3
Shewanella oneidensis MR-1 SO2727 -184 4.4 TTACATGATGCAGCGCACATTT
Shewanella putrefaciens CN-32 Sputcn32_2333 -183 4.4 TTACATGATGCAGCGCACATTT
Shewanella sp W3-18-1 Sputw3181_1675 -183 4.4 TTACATGATGCAGCGCACATTT
Shewanella sp ANA-3 Shewana3_2511 -183 4.4 TTACATGATGCAGCGCACATTT
Shewanella sp MR-4 Shewmr4_2318 -184 4.4 TTACATGATGCAGCGCACATTT
Shewanella sp MR-7 Shewmr7_2388 -184 4.4 TTACATGATGCAGCGCACATTT
Shewanella baltica OS155 Sbal_1793 -184 4.4 TTACATGATGCAGCGCACATTT
Shewanella loihica PV-4 Shew_1724 -224 4.6 TAGTGTGACGCAGATCATGTTT
-174 4.7 ATATTTGATTAAGTGCACATTT
Position: -234
Score: 4.8
Sequence: TTAAGTGATCTGGCTCACTTAA
Locus tag: Shewmr4_2373
Shewmr4_2373 -234 4.8 TTAAGTGATCTGGCTCACTTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2753
Ortholog function: prolyl endopeptidase (EC 3.4.21.26)
Shewanella oneidensis MR-1 SO2753 -235 4.7 TTAAGTGATCTGCCTCACTTAA
Shewanella putrefaciens CN-32 Sputcn32_1602 -234 4.8 TTAAGTGATCTAGCTCACTTAA
Shewanella sp W3-18-1 Sputw3181_2420 -234 4.8 TTAAGTGATCTAGCTCACTTAA
Shewanella sp ANA-3 Shewana3_2536 -234 4.8 TTAAGTGATCTGGCTCACTTAA
Shewanella sp MR-4 Shewmr4_2373 -234 4.8 TTAAGTGATCTGGCTCACTTAA
Shewanella sp MR-7 Shewmr7_2445 -234 4.8 TTAAGTGATCTGGCTCACTTAA
Shewanella baltica OS155 Sbal_1741 -233 4.7 AAAGGTGATCTATATCACTTAA
Shewanella amazonensis SB2B Sama_2091 -226 4.7 TTGTGTGATCTTGCGCACGTTA
Shewanella loihica PV-4 Shew_1522 -276 3.5 ATTTGCGCTTGATTACGCAAAA
Shewanella pealeana ATCC 700345 Spea_2569 -251 3.9 TAGTGTGGGTTTAGTCACACTT
Shewanella halifaxensis HAW-EB4 Shal_1686 -266 3.6 TATTGCGGGGTTTGTCACGTTT
Shewanella piezotolerans WP3 swp_1825 -248 3.6 TTGTGAGTCCTTAATCACGTTT
Shewanella sediminis HAW-EB3 Ssed_1852 -257 3.8 AAGTGTGATCTTGGTCGGTAAA
Shewanella woodyi ATCC 51908 Swoo_2736 -259 3.7 TAGTGTGATCTAGGTTGGGTAA
Position: -167
Score: 4.6
Sequence: AAATGTGATATTGGTCTTAAAT
Locus tag: Shewmr4_2376
Shewmr4_2376 -167 4.6 AAATGTGATATTGGTCTTAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Swoo_2741
Ortholog function: Alkyl hydroperoxide reductase subunit C-like protein
Shewanella putrefaciens CN-32 Sputcn32_1599 -183 4.6 AAATGTGATATTGGTCTTAAAT
Shewanella sp W3-18-1 Sputw3181_2423 -183 4.6 AAATGTGATATTGGTCTTAAAT
Shewanella sp ANA-3 Shewana3_2541 -167 4.6 AAATGTGATATTGGTCTTAAAT
Shewanella sp MR-4 Shewmr4_2376 -167 4.6 AAATGTGATATTGGTCTTAAAT
Shewanella sp MR-7 Shewmr7_2448 -167 4.6 AAATGTGATATTGGTCTTAAAT
Shewanella baltica OS155 Sbal_1738 -183 4.6 AAATGTGATATTGGTCTTAAAT
Shewanella denitrificans OS217 Sden_2091 -88 4.7 GATTGTGATCCCTCTCGCATAT
Shewanella amazonensis SB2B Sama_2094 -115 4.3 TTGTGTGATATTCCTCCAAATT
Shewanella loihica PV-4 Shew_1516 -105 4.1 AAAAGTGACAATGATCCCAAAT
Shewanella halifaxensis HAW-EB4 Shal_1683 -108 4.4 AAAAGTGATATTGATATCAAAT
Shewanella piezotolerans WP3 swp_1821 -108 4.7 AAAAGTGATATTGCTCTCAAAT
Shewanella sediminis HAW-EB3 Ssed_1848 -106 4.4 AAAGGTGATATTGATCCCAAAT
Position: -225
Score: 4.2
Sequence: ATTTAAGACCAATATCACATTT
Locus tag: Shewmr4_2377
Shewmr4_2377 -225 4.2 ATTTAAGACCAATATCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2757
Ortholog function: Histidine permease YuiF
Shewanella oneidensis MR-1 SO2757 -225 4.2 ATTTAAGACCAATATCACATTT
Shewanella putrefaciens CN-32 Sputcn32_1598 -225 4.2 ATTTAAGACCAATATCACATTT
Shewanella sp W3-18-1 Sputw3181_2424 -225 4.2 ATTTAAGACCAATATCACATTT
Shewanella sp ANA-3 Shewana3_2542 -225 4.2 ATTTAAGACCAATATCACATTT
Shewanella sp MR-4 Shewmr4_2377 -225 4.2 ATTTAAGACCAATATCACATTT
Shewanella sp MR-7 Shewmr7_2449 -225 4.2 ATTTAAGACCAATATCACATTT
Shewanella baltica OS155 Sbal_1737 -227 4.2 ATTTAAGACCAATATCACATTT
Shewanella denitrificans OS217 Sden_2092 -208 4.3 ATATGCGAGAGGGATCACAATC
Shewanella frigidimarina NCIMB 400 Sfri_1454 -191 3.5 TTAAATAATAAGTTTCAAATAT
Shewanella amazonensis SB2B Sama_2095 -210 3.9 AATTTGGAGGAATATCACACAA
Shewanella loihica PV-4 Shew_1515 -230 4 ATTTGGGATCATTGTCACTTTT
Shewanella halifaxensis HAW-EB4 Shal_1682 -225 3.9 ATTTGATATCAATATCACTTTT
Shewanella piezotolerans WP3 swp_1820 -77 4.1 ATTTGAGAGCAATATCACTTTT
Shewanella sediminis HAW-EB3 Ssed_1847 -226 4.5 ATTTGGGATCAATATCACCTTT
Shewanella woodyi ATCC 51908 Swoo_2742 -155 4 TTTAGTGCTGTTATTTACACTT
Position: -125
Score: 4.1
Sequence: AATTGTGCCGGATATCACTTTC
Locus tag: Shewmr4_2393
Shewmr4_2393 -125 4.1 AATTGTGCCGGATATCACTTTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2773
Ortholog function: hypothetical protein
Shewanella sp ANA-3 Shewana3_2556 -125 4.1 AATTGTGCCGGATATCACTTTC
Shewanella sp MR-4 Shewmr4_2393 -125 4.1 AATTGTGCCGGATATCACTTTC
Shewanella sp MR-7 Shewmr7_2463 -125 4.1 AATTGTGCCGGATATCACTTTC
Shewanella pealeana ATCC 700345 Spea_2491 -172 4.9 ATATTTGAAGTGTTTCACATAA
Shewanella halifaxensis HAW-EB4 Shal_1780 -174 4.7 ATATTTGAGTTGATTCACAAAA
Position: -82
Score: 4.1
Sequence: AAACGCGAACTAACTCGCATTT
Locus tag: Shewmr4_2411
Shewmr4_2411 -82 4.1 AAACGCGAACTAACTCGCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cdd
Ortholog function: cytidine deaminase (EC 3.5.4.5)
Shewanella oneidensis MR-1 SO2791 -82 4.1 AAACGCGAACTAACTCGCATTT
Shewanella putrefaciens CN-32 Sputcn32_1568 -131 3.8 TATGGTGAAATCGGTCAAATAC
-82 4.2 AAACGCGAGCTAACTCGCATTT
Shewanella sp W3-18-1 Sputw3181_2531 -131 3.8 TATGGTGAAATCGGTCAAATAC
-82 4.2 AAACGCGAGCTAACTCGCATTT
Shewanella sp ANA-3 Shewana3_2573 -82 4.1 AAACGCGAACTAACTCGCATTT
Shewanella sp MR-4 Shewmr4_2411 -82 4.1 AAACGCGAACTAACTCGCATTT
Shewanella sp MR-7 Shewmr7_2481 -82 4.1 AAACGCGAACTAACTCGCATTT
Shewanella baltica OS155 Sbal_1694 -157 3.8 ATTCGTGAATAGACTCACTCTA
-82 4.2 AAACGCGAGCTAACTCGCATTT
Shewanella frigidimarina NCIMB 400 Sfri_1637 -44 3.8 AAATTTTATTTTTATCCAATTT
Shewanella amazonensis SB2B Sama_1974 -82 4 AAATGGGATTAGACTCCCATTA
Shewanella halifaxensis HAW-EB4 Shal_1783 -81 3.9 AACTGAGATCTTCATCTCATTC
Shewanella piezotolerans WP3 swp_3037 -82 4.1 AAGTGCGATCTCTGTCGCATTC
Shewanella sediminis HAW-EB3 Ssed_2618 -82 3.9 AAATGGGAGCTGGATCTCATCA
Shewanella woodyi ATCC 51908 Swoo_2048 -82 3.9 AAATGGGAGAAAGATCCCATTA
Position: -101
Score: 4.7
Sequence: TTATGCGAGCGGAATCACATTT
Locus tag: Shewmr4_2417
Shewmr4_2417 -101 4.7 TTATGCGAGCGGAATCACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2797
Ortholog function: glutaredoxin
Shewanella oneidensis MR-1 SO2797 -70 4.5 TTATGAGAGCAGAATCACATTT
Shewanella sp ANA-3 Shewana3_2579 -102 4.7 TTATGCGAGCGGAATCACATTT
Shewanella sp MR-4 Shewmr4_2417 -101 4.7 TTATGCGAGCGGAATCACATTT
Shewanella sp MR-7 Shewmr7_2487 -88 4.8 TTATGCGAGCGAAATCACATTT
Shewanella sediminis HAW-EB3 Ssed_1830 -53 3.8 TTCTGTGACATGGGTTACACTC
Position: -95
Score: 4
Sequence: TCTTGTGAATTGAGTCACAGAG
Locus tag: Shewmr4_2426
Shewmr4_2426 -95 4 TCTTGTGAATTGAGTCACAGAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO2806
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO2806 -95 4.3 TCTTGTGAATTGAGTCACATAG
Shewanella putrefaciens CN-32 Sputcn32_1554 -95 4 TCTTGTGAATTGAGTCACAGAG
Shewanella sp W3-18-1 Sputw3181_2545 -95 4 TCTTGTGAATTGAGTCACAGAG
Shewanella sp ANA-3 Shewana3_2588 -95 4 TCTTGTGAATTGAGTCACAGAG
Shewanella sp MR-4 Shewmr4_2426 -95 4 TCTTGTGAATTGAGTCACAGAG
Shewanella sp MR-7 Shewmr7_2496 -95 4 TCTTGTGAATTGAGTCACAGAG
Shewanella baltica OS155 Sbal_1679 -94 4.2 ATCTGTGAATTAAGTCACACAG
Shewanella denitrificans OS217 Sden_1453 -35 3.9 ATATTTTATGCCGTTCACTCAT
Shewanella amazonensis SB2B Sama_1287 -85 4 AATTGTGAAGCCAGTCACGGTG
Shewanella pealeana ATCC 700345 Spea_1483 -84 4.4 AATTGTGAATAACGTCACACAG
Shewanella halifaxensis HAW-EB4 Shal_1567 -84 4.7 AATTGTGAACAACATCACACAG
Shewanella piezotolerans WP3 swp_1689 27 4.3 AACTGTGAAAGGTATCACACAC
Shewanella sediminis HAW-EB3 Ssed_2877 -82 4.5 TAATGTGAATGGCGTCACACAG
Shewanella woodyi ATCC 51908 Swoo_1771 -81 4.6 TATTGTGAAAGTCATCACACAG
Position: -140
Score: 4.4
Sequence: TTTTGTGATGTTTCTCTACATA
Locus tag: Shewmr4_2468
Shewmr4_2468 -140 4.4 TTTTGTGATGTTTCTCTACATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1821
Ortholog function: outer membrane porin, putative
Shewanella putrefaciens CN-32 Sputcn32_1515 -140 4.4 TTTTGTGATGTTAATCTACATA
Shewanella sp W3-18-1 Sputw3181_2585 -140 4.4 TTTTGTGATGTTAATCTACATA
Shewanella sp ANA-3 Shewana3_2628 -140 4.4 TTTTGTGATGTTTCTCTACATA
Shewanella sp MR-4 Shewmr4_2468 -140 4.4 TTTTGTGATGTTTCTCTACATA
Shewanella sp MR-7 Shewmr7_2536 -140 4.4 TTTTGTGATGTTTCTCTACATA
Shewanella baltica OS155 Sbal_1631 -143 4.5 TTTTGTGATGTTAATCGACATA
Shewanella frigidimarina NCIMB 400 Sfri_3603 -307 4.4 AGTCGCGATCTACATCAAATAA
-140 4.2 TTATATGAGATATATCGCCTTT
Shewanella amazonensis SB2B Sama_1251 -168 3.9 TTATCTGATAGAGATTTCAATT
-140 4.5 TGTTGTGATTTTTAACACGTTT
Position: -151
Score: 4.1
Sequence: CGGTGTGATCAGGATCTCAGTT
Locus tag: Shewmr4_2501
Shewmr4_2501 -151 4.1 CGGTGTGATCAGGATCTCAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: miaE
Ortholog function: tRNA-(ms[2]io[6]A)-hydroxylase (EC 1.-.-.-)
Shewanella oneidensis MR-1 SO1788 -151 4.3 CTGTGTGATCAGGATCTCAGTT
-12 3.7 TTGAGTGATCCCATGCAACAAT
Shewanella putrefaciens CN-32 Sputcn32_1484 -105 4.5 TCATGTGATCCCGATCTCAGTT
Shewanella sp W3-18-1 Sputw3181_2617 -105 4.5 TCATGTGATCCCGATCTCAGTT
Shewanella sp ANA-3 Shewana3_2667 -150 4.5 CTATGTGATCAGGATCTCAGTT
Shewanella sp MR-4 Shewmr4_2501 -151 4.1 CGGTGTGATCAGGATCTCAGTT
Shewanella sp MR-7 Shewmr7_2569 -150 4.1 CGGTGTGATCAGGATCTCAGTT
Shewanella baltica OS155 Sbal_1598 -149 4.3 CTGTGTGATCAGGATCTCAGTT
Position: -151
Score: 3.7
Sequence: AACTGAGATCCTGATCACACCG
Locus tag: Shewmr4_2502
Shewmr4_2502 -151 3.7 AACTGAGATCCTGATCACACCG
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1787
Ortholog function: probable membrane protein YPO2362
Shewanella oneidensis MR-1 SO1787 -149 4.2 AACTGAGATCCTGATCACACAG
Shewanella putrefaciens CN-32 Sputcn32_1483 -154 4 AACTGAGATCGGGATCACATGA
Shewanella sp W3-18-1 Sputw3181_2618 -154 4 AACTGAGATCGGGATCACATGA
Shewanella sp ANA-3 Shewana3_2668 -151 4.4 AACTGAGATCCTGATCACATAG
Shewanella sp MR-4 Shewmr4_2502 -151 3.7 AACTGAGATCCTGATCACACCG
Shewanella sp MR-7 Shewmr7_2570 -151 3.7 AACTGAGATCCTGATCACACCG
Shewanella baltica OS155 Sbal_1597 -156 4.2 AACTGAGATCCTGATCACACAG
Position: -276
Score: 5
Sequence: AAGTGTGATCTTGTTCTCACTT
Position: -153
Score: 4.4
Sequence: CATTGAGATTTTTGTCACATAA
Locus tag: Shewmr4_2505
Shewmr4_2505 -276 5 AAGTGTGATCTTGTTCTCACTT
-153 4.4 CATTGAGATTTTTGTCACATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: feoA
Ortholog function: Ferrous iron transport protein A
Shewanella oneidensis MR-1 SO1783 -153 4 CATAGAGATTTTTGTCACATAA
Shewanella putrefaciens CN-32 Sputcn32_1480 -155 4.6 CATTGGGATTTTTATCACATAA
Shewanella sp W3-18-1 Sputw3181_2621 -155 4.6 CATTGGGATTTTTATCACATAA
Shewanella sp ANA-3 Shewana3_2671 -276 5 AAGTGTGATCTTGTTCTCACTT
-153 4.4 CATTGAGATTTTTGTCACATAA
Shewanella sp MR-4 Shewmr4_2505 -276 5 AAGTGTGATCTTGTTCTCACTT
-153 4.4 CATTGAGATTTTTGTCACATAA
Shewanella sp MR-7 Shewmr7_2573 -276 5 AAGTGTGATCTTGTTCTCACTT
-153 4.4 CATTGAGATTTTTGTCACATAA
Shewanella baltica OS155 Sbal_1594 -276 5 AAGCGTGATGTTGATCACGTTT
Shewanella denitrificans OS217 Sden_2415 -148 3.9 ATCTGCGGTATTTATCACATAA
Shewanella amazonensis SB2B Sama_1214 -228 3.8 AAGTGTGATGAGTGTCACGCCG
Shewanella loihica PV-4 Shew_2518 -245 5.2 ATATGTGATCTAGATCACGTTG
-155 4.2 GATTGAGATATCTGTCACATAA
Shewanella pealeana ATCC 700345 Spea_2691 -247 5.5 TTATGTGATGCGTATCACACTT
-158 4.2 AGTTGAGAGTTTTGTCACATAA
Shewanella halifaxensis HAW-EB4 Shal_2777 -279 4.7 AAGTGTGATCTGTGTCAAGTTT
-158 4.7 AGTTGAGATATTTATCACATAA
Shewanella piezotolerans WP3 swp_3271 -280 4.6 AAGCGTGATCTACGTCACACTG
-157 4.2 AGTTGAGAGATTTGTCACATAA
Shewanella sediminis HAW-EB3 Ssed_1531 -275 4.9 AAGTGTGATCTTGGTCACGCTA
-158 4.3 AGTTGAGACTTTTGTCACATAA
Shewanella woodyi ATCC 51908 Swoo_3123 -272 4.7 AATCGTGACTTATATCACTTAA
-157 4.2 AGTTGGGACTTTTGTCACATAA
Position: -295
Score: 4.4
Sequence: TTATGTGACAAAAATCTCAATG
Position: -172
Score: 4.3
Sequence: AAGTGAGAACAAGATCACACTT
Locus tag: Shewmr4_2506
Shewmr4_2506 -295 4.4 TTATGTGACAAAAATCTCAATG
-172 4.3 AAGTGAGAACAAGATCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtrD
Ortholog function: periplasmic decaheme cytochrome c, MtrD
Shewanella oneidensis MR-1 SO1782 -339 3.8 TTATGTGACAAAAATCTCTATG
Shewanella sp ANA-3 Shewana3_2672 -295 4.4 TTATGTGACAAAAATCTCAATG
-172 4.3 AAGTGAGAACAAGATCACACTT
Shewanella sp MR-4 Shewmr4_2506 -295 4.4 TTATGTGACAAAAATCTCAATG
-172 4.3 AAGTGAGAACAAGATCACACTT
Shewanella sp MR-7 Shewmr7_2574 -295 4.4 TTATGTGACAAAAATCTCAATG
-172 4.3 AAGTGAGAACAAGATCACACTT
Shewanella baltica OS155 Sbal_1593 -304 3.8 TTATGTGACAAAAATACCAATG
-181 4.8 AAACGTGATCAACATCACGCTT
Shewanella amazonensis SB2B Sama_1213 -189 3.9 CGGCGTGACACTCATCACACTT
Shewanella loihica PV-4 Shew_2519 -260 4.5 TTATGTGACAGATATCTCAATC
-170 5.3 CAACGTGATCTAGATCACATAT
Shewanella pealeana ATCC 700345 Spea_2692 -286 4.1 TTATGTGACAAAACTCTCAACT
-197 5.4 AAGTGTGATACGCATCACATAA
Shewanella halifaxensis HAW-EB4 Shal_2778 -305 4.5 TTATGTGATAAATATCTCAACT
-184 4.6 AAACTTGACACAGATCACACTT
Shewanella piezotolerans WP3 swp_3272 -308 4.2 TTATGTGACAAATCTCTCAACT
-185 4.6 CAGTGTGACGTAGATCACGCTT
Shewanella sediminis HAW-EB3 Ssed_1530 -291 4 TTATGTGACAAAAGTCTCAACT
-174 4.8 TAGCGTGACCAAGATCACACTT
Position: -165
Score: 4.1
Sequence: TAGTCAGATCTCAATCACATTA
Locus tag: Shewmr4_2509
Shewmr4_2509 -165 4.1 TAGTCAGATCTCAATCACATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: omcA
Ortholog function: surface localized decaheme cytochrome c lipoprotein, OmcA
Shewanella sp ANA-3 Shewana3_2675 -295 4.4 TTATGTGACAAAAATCTCAATG
-172 4.3 AAGTGAGAACAAGATCACACTT
Shewanella sp MR-4 Shewmr4_2509 -295 4.4 TTATGTGACAAAAATCTCAATG
-172 4.3 AAGTGAGAACAAGATCACACTT
Shewanella sp MR-7 Shewmr7_2577 -295 4.4 TTATGTGACAAAAATCTCAATG
-172 4.3 AAGTGAGAACAAGATCACACTT
Shewanella baltica OS155 Sbal_1590 -304 3.8 TTATGTGACAAAAATACCAATG
-181 4.8 AAACGTGATCAACATCACGCTT
Shewanella amazonensis SB2B Sama_1210 -189 3.9 CGGCGTGACACTCATCACACTT
Position: -269
Score: 3.5
Sequence: TTTTATTTTTTATCTCACAATC
Position: -189
Score: 3.5
Sequence: TAGAAAGATCCAAGTCACACAT
Locus tag: Shewmr4_2510
Shewmr4_2510 -269 3.5 TTTTATTTTTTATCTCACAATC
-189 3.5 TAGAAAGATCCAAGTCACACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtrC
Ortholog function: surface localized decaheme cytochrome c lipoprotein, MtrC
Shewanella oneidensis MR-1 SO1778 -248 3.7 TGTTGTTTTTTTGCTCTCAATT
-190 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella putrefaciens CN-32 Sputcn32_1478 -190 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella sp W3-18-1 Sputw3181_2623 -190 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella sp ANA-3 Shewana3_2676 -189 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella sp MR-4 Shewmr4_2510 -189 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella sp MR-7 Shewmr7_2578 -189 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella baltica OS155 Sbal_1589 -190 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella frigidimarina NCIMB 400 Sfri_2637 -164 3.8 TAGGCTGATCATCATCACACAA
Shewanella amazonensis SB2B Sama_1208 -230 3.9 TTTTTTGATCTGAAACAGCTTT
-178 3.6 TAGCCGGATCCAGTTCACACAT
Shewanella loihica PV-4 Shew_2525 -179 3.6 TAGAAAGATCTCGGTCACACAT
Shewanella halifaxensis HAW-EB4 Shal_2784 -264 4 TTTTATTACATTTATCACGTAT
Shewanella sediminis HAW-EB3 Ssed_1525 -191 4 TAGGCTGATCTAGGTCACACAT
Shewanella woodyi ATCC 51908 Swoo_3125 -288 3.7 ATGAGTTACAACTTTCACACAT
Position: 14
Score: 3.5
Sequence: CAATTTGATCACTCTAGCGTTA
Locus tag: Shewmr4_2512
Shewmr4_2512 14 3.5 CAATTTGATCACTCTAGCGTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtrB
Ortholog function: outer membrane protein, MtrB
Shewanella oneidensis MR-1 SO1776 -248 3.7 TGTTGTTTTTTTGCTCTCAATT
-190 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella putrefaciens CN-32 Sputcn32_1476 -190 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella sp W3-18-1 Sputw3181_2625 -190 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella sp ANA-3 Shewana3_2678 -189 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella sp MR-4 Shewmr4_2512 -189 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella sp MR-7 Shewmr7_2580 -189 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella baltica OS155 Sbal_1587 -190 3.5 TAGAAAGATCCAAGTCACACAT
Shewanella frigidimarina NCIMB 400 Sfri_2639 -164 3.8 TAGGCTGATCATCATCACACAA
Shewanella amazonensis SB2B Sama_1206 -230 3.9 TTTTTTGATCTGAAACAGCTTT
-178 3.6 TAGCCGGATCCAGTTCACACAT
Shewanella loihica PV-4 Shew_2527 -179 3.6 TAGAAAGATCTCGGTCACACAT
Shewanella halifaxensis HAW-EB4 Shal_2786 -264 4 TTTTATTACATTTATCACGTAT
Shewanella sediminis HAW-EB3 Ssed_1523 -191 4 TAGGCTGATCTAGGTCACACAT
Shewanella woodyi ATCC 51908 Swoo_3127 -288 3.7 ATGAGTTACAACTTTCACACAT
Position: -96
Score: 4.5
Sequence: AAGTGTGATACTTGCCACAAAA
Locus tag: Shewmr4_2587
Shewmr4_2587 -96 4.5 AAGTGTGATACTTGCCACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1689
Ortholog function: lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); copper-translocating P-type ATPase (EC 3.6.3.4)
Shewanella oneidensis MR-1 SO1689 -96 4.5 AAGTGTGATACTTGCCACAAAA
Shewanella sp ANA-3 Shewana3_2761 -96 4.5 AAGTGTGATACTTGCCACAAAA
Shewanella sp MR-4 Shewmr4_2587 -96 4.5 AAGTGTGATACTTGCCACAAAA
Shewanella sp MR-7 Shewmr7_2654 -96 4.6 AAGTGTGATATTTGCCACAAAA
Position: -196
Score: 5.1
Sequence: AAATGTGATTTTGCTCACGCTA
Locus tag: Shewmr4_2604
Shewmr4_2604 -196 5.1 AAATGTGATTTTGCTCACGCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fahA
Ortholog function: Fumarylacetoacetate hydrolase family protein
Shewanella oneidensis MR-1 SO1670 -200 5.1 AAATGTGATTTTGTTCACGCTA
Shewanella putrefaciens CN-32 Sputcn32_1389 -229 5 AAATGTGATTTGTGTCACGCTA
Shewanella sp W3-18-1 Sputw3181_2712 -229 5 AAATGTGATTTGTGTCACGCTA
Shewanella sp ANA-3 Shewana3_2778 -197 5.1 AAATGTGATTTTGCTCACGCTA
Shewanella sp MR-4 Shewmr4_2604 -196 5.1 AAATGTGATTTTGCTCACGCTA
Shewanella sp MR-7 Shewmr7_2671 -196 5.1 AAATGTGATTTTGCTCACGCTA
Shewanella baltica OS155 Sbal_1487 -235 5 AAATGTGATTTTGGTCACGCTA
Shewanella denitrificans OS217 Sden_2592 -107 4.7 AAATGTGATTTTGCGCACGCTA
Shewanella frigidimarina NCIMB 400 Sfri_1331 -116 4.1 AAATGTGATTTGGTACTTACTA
Shewanella amazonensis SB2B Sama_2219 -111 5 AATTGTGATTTGAGTCACGCTA
Shewanella loihica PV-4 Shew_1438 -130 4.4 GAGTGTGATTTGTATCACGCTA
Shewanella pealeana ATCC 700345 Spea_1451 -158 5.3 AAGTGTGATTTCGTTCACACTA
Shewanella halifaxensis HAW-EB4 Shal_1534 -144 4.5 CAGTGTGATTTATCTCACGCTA
Shewanella piezotolerans WP3 swp_1653 -140 5 TAGTGTGATTTAGCTCACGCTA
Shewanella sediminis HAW-EB3 Ssed_2927 -116 4.1 GAGCGTGATTCATGTCACACTA
Shewanella woodyi ATCC 51908 Swoo_1718 -133 5 TATTGTGATTTGTGTCACGCTA
Position: -75
Score: 4.5
Sequence: AACTGTGAGGGAGTTAACAAAA
Locus tag: Shewmr4_2607
Shewmr4_2607 -75 4.5 AACTGTGAGGGAGTTAACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: phhA
Ortholog function: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Shewanella oneidensis MR-1 SO1666 -75 4.5 AACTGTGAGGGAGTTAACAAAA
Shewanella putrefaciens CN-32 Sputcn32_1386 -75 4.7 AAGTGTGAGGGAGTTAACAAAA
Shewanella sp W3-18-1 Sputw3181_2715 -75 4.7 AAGTGTGAGGGAGTTAACAAAA
Shewanella sp ANA-3 Shewana3_2781 -75 4.5 AACTGTGAGGGAGTTAACAAAA
Shewanella sp MR-4 Shewmr4_2607 -75 4.5 AACTGTGAGGGAGTTAACAAAA
Shewanella sp MR-7 Shewmr7_2674 -75 4.5 AACTGTGAGGGAGTTAACAAAA
Shewanella baltica OS155 Sbal_1484 -75 4.7 AAGTGTGAGGGAGTTAACAAAT
Shewanella denitrificans OS217 Sden_2595 -61 4.1 AATTGTGCGCCATGGCACACTA
Shewanella frigidimarina NCIMB 400 Sfri_1328 -74 4.5 AACTGTGAGGGAGTTAACAAAA
Shewanella amazonensis SB2B Sama_2222 -76 4.6 AAACGTGAGGCAGTTAACAAAA
Shewanella loihica PV-4 Shew_1435 -40 4.7 AAGTGTGATCCTGTTAACAAAC
Shewanella pealeana ATCC 700345 Spea_1448 -126 4.9 AACTGTGATCGGGTTAACAATT
Shewanella halifaxensis HAW-EB4 Shal_1531 -86 4.7 AACCGTGATCTAGTTAACAAAA
Shewanella piezotolerans WP3 swp_1650 -76 5 AACTGTGATCTGGTTAACAAAA
Shewanella sediminis HAW-EB3 Ssed_2930 -75 4.8 AACTGTGATGGAGTTAACAAAA
Shewanella woodyi ATCC 51908 Swoo_1715 -74 4.7 AAGTGTGAAGTGGTTAACAAAA
Position: -270
Score: 4.4
Sequence: TTTTGTTAACTCCCTCACAGTT
Locus tag: Shewmr4_2608
Shewmr4_2608 -270 4.4 TTTTGTTAACTCCCTCACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: galU
Ortholog function: UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9)
Shewanella amazonensis SB2B Sama_2223 -304 4.5 TTTTGTTAACTGCCTCACGTTT
Position: -202
Score: 4
Sequence: ATTTGTTACCCACCTCTTATTT
Locus tag: Shewmr4_2613
Shewmr4_2613 -202 4 ATTTGTTACCCACCTCTTATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mtrF
Ortholog function: decaheme cytochrome c MtrF
Shewanella putrefaciens CN-32 Sputcn32_1380 -201 4.5 ATTTGCAATATTCATCACATTT
Shewanella putrefaciens CN-32 Sputcn32_1380 -201 4.5 ATTTGCAATATTCATCACATTT
Shewanella sp W3-18-1 Sputw3181_2721 -201 4.5 ATTTGCAATATTCATCACATTT
Shewanella sp W3-18-1 Sputw3181_2721 -201 4.5 ATTTGCAATATTCATCACATTT
Shewanella sp ANA-3 Shewana3_2787 -201 3.9 ATCTGCGAGATACCTCATATAT
Shewanella sp ANA-3 Shewana3_2787 -201 3.9 ATCTGCGAGATACCTCATATAT
Shewanella sp MR-4 Shewmr4_2613 -202 4 ATTTGTTACCCACCTCTTATTT
Shewanella sp MR-4 Shewmr4_2613 -202 4 ATTTGTTACCCACCTCTTATTT
Shewanella sp MR-7 Shewmr7_2680 -202 4 ATTTGTTACCCACCTCTTATTT
Shewanella sp MR-7 Shewmr7_2680 -202 4 ATTTGTTACCCACCTCTTATTT
Shewanella baltica OS155 Sbal_1478 -202 4.1 AATTGTGATGCTCATCATGGCT
Shewanella baltica OS155 Sbal_1478 -202 4.1 AATTGTGATGCTCATCATGGCT
Shewanella amazonensis SB2B Sama_2228 -304 4.5 TTTTGTTAACTGCCTCACGTTT
Position: -136
Score: 4.1
Sequence: TTCCTTGATTTAGATCACACTC
Locus tag: Shewmr4_2656
Shewmr4_2656 -136 4.1 TTCCTTGATTTAGATCACACTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1613
Ortholog function: hypothetical protein
Shewanella oneidensis MR-1 SO1613 -75 4 TTCCTTGATTTAGCTCACACTC
Shewanella putrefaciens CN-32 Sputcn32_1334 -142 4.1 TTCCTTGATTTAGATCACACTC
Shewanella sp W3-18-1 Sputw3181_2769 -142 4.1 TTCCTTGATTTAGATCACACTC
Shewanella sp ANA-3 Shewana3_2830 -136 4.1 TTCCTTGATTTAGATCACACTC
Shewanella sp MR-4 Shewmr4_2656 -136 4.1 TTCCTTGATTTAGATCACACTC
Shewanella sp MR-7 Shewmr7_2723 -136 4.1 TTCCTTGATTTAGATCACACTC
Shewanella baltica OS155 Sbal_1436 -138 4.1 TTCCTTGACTTAGCTCACACTT
Shewanella amazonensis SB2B Sama_1125 -126 4.5 TTCCTTGATCCAGATCACACAT
Shewanella halifaxensis HAW-EB4 Shal_2994 -181 4.6 TTCCTTGATCTAGATCACACTA
Shewanella piezotolerans WP3 swp_3538 -271 4.4 TTCCTTGATCGAGATCACACAA
Position: -127
Score: 4.5
Sequence: AATAGTGAGCAATATCACGATT
Locus tag: Shewmr4_2719
Shewmr4_2719 -127 4.5 AATAGTGAGCAATATCACGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1539
Ortholog function: Probable acylaminoacyl-peptidase (EC 3.4.19.1)
Shewanella putrefaciens CN-32 Sputcn32_1287 -127 4.5 AATAGTGAGCGATATCACGATT
Shewanella sp W3-18-1 Sputw3181_2819 -127 4.5 AATAGTGAGCGATATCACGATT
Shewanella sp ANA-3 Shewana3_2889 -127 4.5 AATAGTGAGCAATATCACGATT
Shewanella sp MR-4 Shewmr4_2719 -127 4.5 AATAGTGAGCAATATCACGATT
Shewanella sp MR-7 Shewmr7_2790 -127 4.5 AATAGTGAGCAATATCACGATT
Shewanella baltica OS155 Sbal_1369 -128 4.5 AATAGTGAGCAATATCACGATT
Shewanella frigidimarina NCIMB 400 Sfri_2778 -313 4.7 AATAGTGAGTATTATCACATTA
Shewanella amazonensis SB2B Sama_2422 -183 4.7 TTATGTGATTTATGTCTCGATT
Shewanella loihica PV-4 Shew_2759 -171 4.4 AATAGTGAGCAATCTCACGTTT
Shewanella pealeana ATCC 700345 Spea_2979 -113 4.3 AAGAGTGAGCGATCTCACGTTT
Shewanella halifaxensis HAW-EB4 Shal_3068 -114 4.4 AATAGTGAGCAATCTCACGTTT
Shewanella piezotolerans WP3 swp_3605 -144 4.2 AAAGGTGAGCAATCTCACGTTT
Shewanella sediminis HAW-EB3 Ssed_3317 -103 4.8 AATAGTGAGCAATCTCACATTT
Shewanella woodyi ATCC 51908 Swoo_3465 -159 4.4 AATAGTGAGCAGTCTCACGTTT
Position: -149
Score: 4.7
Sequence: AATCGTGATATTGCTCACTATT
Locus tag: Shewmr4_2720
Shewmr4_2720 -149 4.7 AATCGTGATATTGCTCACTATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: icd
Ortholog function: Isocitrate dehydrogenase [NAD] (EC 1.1.1.41)
Shewanella oneidensis MR-1 SO1538 -149 4.7 ATTCGTGATATTGCTCACTATT
Shewanella putrefaciens CN-32 Sputcn32_1286 -148 4.7 AATCGTGATATCGCTCACTATT
Shewanella sp W3-18-1 Sputw3181_2820 -148 4.7 AATCGTGATATCGCTCACTATT
Shewanella sp ANA-3 Shewana3_2890 -149 4.7 AATCGTGATATTGCTCACTATT
Shewanella sp MR-4 Shewmr4_2720 -149 4.7 AATCGTGATATTGCTCACTATT
Shewanella sp MR-7 Shewmr7_2791 -149 4.7 AATCGTGATATTGCTCACTATT
Shewanella baltica OS155 Sbal_1368 -149 4.7 AATCGTGATATTGCTCACTATT
Shewanella denitrificans OS217 Sden_2561 -143 3.8 AAAAGGGATATTTCTCACTAAT
Shewanella frigidimarina NCIMB 400 Sfri_2779 -148 4.7 TAATGTGATAATACTCACTATT
Shewanella amazonensis SB2B Sama_2423 -89 4.5 AATCGAGACATAAATCACATAA
Shewanella loihica PV-4 Shew_2760 -150 4.4 AAACGTGAGATTGCTCACTATT
Shewanella pealeana ATCC 700345 Spea_2980 -146 4.2 AAACGTGAGATCGCTCACTCTT
Shewanella halifaxensis HAW-EB4 Shal_3069 -149 4.4 AAACGTGAGATTGCTCACTATT
Shewanella piezotolerans WP3 swp_3606 -293 4.6 AAACGTGAGATTGCTCACCTTT
Shewanella sediminis HAW-EB3 Ssed_3318 -151 4.7 AAATGTGAGATTGCTCACTATT
Shewanella woodyi ATCC 51908 Swoo_3466 -148 4.3 AAACGTGAGACTGCTCACTATT
Position: -263
Score: 4.1
Sequence: TCGAGTGACATAGATCACAGTT
Position: -181
Score: 4.2
Sequence: CAAAATGATCTAGATCATATTA
Locus tag: Shewmr4_2734
Shewmr4_2734 -263 4.1 TCGAGTGACATAGATCACAGTT
-181 4.2 CAAAATGATCTAGATCATATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: lldP
Ortholog function: L-lactate permease
Shewanella oneidensis MR-1 SO1522 -262 4.6 TTAAGTGACACCGATCACAGTT
-180 4.2 CAAAATGATCTAGATCATATAA
Shewanella sp MR-4 Shewmr4_2734 -263 4.1 TCGAGTGACATAGATCACAGTT
-181 4.2 CAAAATGATCTAGATCATATTA
Shewanella sp MR-7 Shewmr7_2807 -263 4.1 TCGAGTGACATAGATCACAGTT
-181 4.2 CAAAATGATCTAGATCATATTA
Shewanella frigidimarina NCIMB 400 Sfri_2793 -298 4.3 TCTAGTGAGCCCCTTCACATTA
-197 3.7 AAACGTGACCTCAAACACGCAC
Shewanella pealeana ATCC 700345 Spea_2994 -276 4 TTAGGTGACACAGGTCACACCA
-241 4.1 AACCGTGACAGATCTCACAATC
Shewanella halifaxensis HAW-EB4 Shal_3083 -300 4.5 TTACGTGACACGGATCACAGAG
-265 4.5 AACTGTGATCAGTCTCACTAAT
Position: -271
Score: 4.5
Sequence: TAATGTTAGCCCCCTCACACTT
Locus tag: Shewmr4_2741
Shewmr4_2741 -271 4.5 TAATGTTAGCCCCCTCACACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Shewana3_2910
Ortholog function: putative membrane protein
Shewanella sp ANA-3 Shewana3_2910 -280 4.3 TTATTAGATGGTCATCACACTT
Shewanella sp MR-4 Shewmr4_2741 -271 4.5 TAATGTTAGCCCCCTCACACTT
Shewanella sp MR-7 Shewmr7_2819 -271 4.5 TAATGTTAGCCTCCTCACACTT
Position: -234
Score: 4.3
Sequence: AGATGTGATCTAGATCGGCTTA
Locus tag: Shewmr4_2761
Shewmr4_2761 -234 4.3 AGATGTGATCTAGATCGGCTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Sputcn32_1245
Ortholog function: transcriptional regulator, MarR family
Shewanella putrefaciens CN-32 Sputcn32_1245 -263 4.5 ATTTGTGACACAGATCGAATTG
-234 3.8 ATTTGTAAGTGATTTCCCACTA
Shewanella putrefaciens CN-32 Sputcn32_1245 -263 4.5 ATTTGTGACACAGATCGAATTG
-234 3.8 ATTTGTAAGTGATTTCCCACTA
Shewanella sp W3-18-1 Sputw3181_2859 -263 4.5 ATTTGTGACGCAGATCGAATTG
-234 3.8 ATTTGTAAGTGATTTCCCACTA
Shewanella sp W3-18-1 Sputw3181_2859 -263 4.5 ATTTGTGACGCAGATCGAATTG
-234 3.8 ATTTGTAAGTGATTTCCCACTA
Shewanella sp ANA-3 Shewana3_2937 -234 4.3 AGATGTGATCTAGATCGGCTTA
Shewanella sp ANA-3 Shewana3_2937 -234 4.3 AGATGTGATCTAGATCGGCTTA
Shewanella sp MR-4 Shewmr4_2761 -234 4.3 AGATGTGATCTAGATCGGCTTA
Shewanella sp MR-4 Shewmr4_2761 -234 4.3 AGATGTGATCTAGATCGGCTTA
Shewanella sp MR-7 Shewmr7_2839 -255 4.3 AGATGTGATCTAGATCGGCTTA
Shewanella sp MR-7 Shewmr7_2839 -255 4.3 AGATGTGATCTAGATCGGCTTA
Shewanella frigidimarina NCIMB 400 Sfri_1943 -111 4.9 TGTTGTGATCTATATCAAGTTA
Shewanella pealeana ATCC 700345 Spea_1004 -164 4.1 ATGCGTGAGGTGAGTCACGCTT
-135 3.7 AAGCTTGATCGTTATAACCCTA
Shewanella halifaxensis HAW-EB4 Shal_1054 -163 4.3 ATCTGTGAACCTTGTCGCATTT
Shewanella piezotolerans WP3 swp_3815 -141 4.7 TTCTGTGATTCAGGTCGCAAAT
Position: -150
Score: 4.2
Sequence: AAATGTTATCTTTATCACTCAG
Locus tag: Shewmr4_2806
Shewmr4_2806 -150 4.2 AAATGTTATCTTTATCACTCAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1389
Ortholog function: ROK family protein, in a cluster with chitinase
Shewanella oneidensis MR-1 SO1389 -150 3.8 AACTGTTAGCTTTATCACTCAA
Shewanella sp ANA-3 Shewana3_2985 -150 4.2 AAATGTTATCTTTATCACTCAG
Shewanella sp MR-4 Shewmr4_2806 -150 4.2 AAATGTTATCTTTATCACTCAG
Shewanella sp MR-7 Shewmr7_2889 -150 4.5 AAATGTTATCTTTATCACTCAA
Shewanella baltica OS155 Sbal_3084 -180 4.4 TTGTGTGATTCTTAGCATAAAA
Position: -233
Score: 4.2
Sequence: CTGAGTGATAAAGATAACATTT
Locus tag: Shewmr4_2807
Shewmr4_2807 -233 4.2 CTGAGTGATAAAGATAACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1388
Ortholog function: Xaa-Pro aminopeptidase (EC 3.4.11.9)
Shewanella oneidensis MR-1 SO1388 -232 4.1 TTGAGTGATAAAGCTAACAGTT
Shewanella sp ANA-3 Shewana3_2986 -233 4.2 CTGAGTGATAAAGATAACATTT
Shewanella sp MR-4 Shewmr4_2807 -233 4.2 CTGAGTGATAAAGATAACATTT
Shewanella sp MR-7 Shewmr7_2890 -233 4.5 TTGAGTGATAAAGATAACATTT
Shewanella baltica OS155 Sbal_3085 -234 4.2 TTTTATGCTAAGAATCACACAA
Shewanella denitrificans OS217 Sden_0887 -161 3.7 TATTGTATACAATATCACGTTA
Position: -124
Score: 4
Sequence: TAAGGTGATCTCCCTCTAAGAT
Locus tag: Shewmr4_2832
Shewmr4_2832 -124 4 TAAGGTGATCTCCCTCTAAGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hcp
Ortholog function: Hydroxylamine reductase (EC 1.7.-.-)
Shewanella oneidensis MR-1 SO1363 -124 4.2 TAAAGTGATCTTTCTCTAAGAT
Shewanella putrefaciens CN-32 Sputcn32_1174 -124 4.3 TAAGGTGATAACCCTCGCAAAT
Shewanella sp W3-18-1 Sputw3181_2990 -124 4.3 TAAGGTGATAACCCTCGCAAAT
Shewanella sp MR-4 Shewmr4_2832 -124 4 TAAGGTGATCTCCCTCTAAGAT
Shewanella sp MR-7 Shewmr7_2914 -124 3.6 CAAGGTGATCTCTCTCTAAGAT
Shewanella baltica OS155 Sbal_1216 -124 4.1 TAAGGTGATCGTTCTCTAATAT
Shewanella frigidimarina NCIMB 400 Sfri_3609 -125 4 GAAGGTGATGTGGCTCATAAAA
Shewanella amazonensis SB2B Sama_0895 -113 3.6 TAAGATGATCTGCTTCAAGGAA
Shewanella loihica PV-4 Shew_1069 -125 4.5 TAATTTGATCCGCTTCATAGTT
Shewanella pealeana ATCC 700345 Spea_1055 -125 4.5 AAAAGTGATCTCTTTCATAGTT
Shewanella halifaxensis HAW-EB4 Shal_1103 -96 4.3 TAAGGTGATCTCTTTCATGTTT
Shewanella piezotolerans WP3 swp_3762 -42 4.4 TAAGGTGATCTCTTTCATAGTT
Shewanella sediminis HAW-EB3 Ssed_1165 -170 3.4 TAATGCAATTGGTATTATAATT
Shewanella woodyi ATCC 51908 Swoo_1260 -125 4.2 GAATTTGATCTGTCTCAAACTT
Position: -162
Score: 4.4
Sequence: TGGATTGATCCAGATCACAAAT
Locus tag: Shewmr4_2867
Shewmr4_2867 -162 4.4 TGGATTGATCCAGATCACAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cyaC
Ortholog function: Adenylate cyclase (EC 4.6.1.1)
Shewanella oneidensis MR-1 SO1329 -162 4.7 TGTATTGATCCAGATCACAAAT
Shewanella putrefaciens CN-32 Sputcn32_1140 -101 4.7 TGTATTGATCCAGATCACAAAT
Shewanella sp W3-18-1 Sputw3181_3024 -101 4.7 TGTATTGATCCAGATCACAAAT
Shewanella sp ANA-3 Shewana3_3045 -162 4.4 TGGATTGATCCAGATCACAAAT
Shewanella sp MR-4 Shewmr4_2867 -162 4.4 TGGATTGATCCAGATCACAAAT
Shewanella sp MR-7 Shewmr7_2949 -162 4.4 TGGATTGATCCAGATCACAAAT
Shewanella baltica OS155 Sbal_1182 -101 4.7 TAGATTGATCCAGATCACAAAT
Shewanella denitrificans OS217 Sden_2784 -157 4.8 TGAATTGATCTAGATCACATTT
Shewanella frigidimarina NCIMB 400 Sfri_2947 -158 4.4 TCTATTGATCTAAATCACAAAT
Shewanella amazonensis SB2B Sama_0861 -102 4.2 TGAATTGATTCAGATCACGTTA
Shewanella loihica PV-4 Shew_1036 -162 4.6 TCATTTGACTTAGATCACAAAT
Shewanella pealeana ATCC 700345 Spea_1019 -100 4.6 TCATTTGACTTAGATCACAAAT
Shewanella halifaxensis HAW-EB4 Shal_1065 -99 5.1 TTATTTGACTTAGATCACAAAT
Shewanella piezotolerans WP3 swp_3798 -98 4.6 TCATTTGACTTAGATCACAAAT
Shewanella sediminis HAW-EB3 Ssed_1130 -103 4.3 TCATTTGACAAAGATCACAAAT
Shewanella woodyi ATCC 51908 Swoo_1225 -96 4.3 TCATTTGACTAAGATCACAAAT
Position: -109
Score: 4
Sequence: AAAATCGATTTTGCTCACACTA
Locus tag: Shewmr4_2868
Shewmr4_2868 -109 4 AAAATCGATTTTGCTCACACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1328
Ortholog function: transcriptional regulator, LysR family
Shewanella oneidensis MR-1 SO1328 -109 4 AAAATCGATTTTGCTCACACAA
Shewanella putrefaciens CN-32 Sputcn32_1139 -109 3.8 AATGGCGATTCTGCTCACACTC
Shewanella sp W3-18-1 Sputw3181_3025 -109 3.9 AATGGCGATTCGGCTCACACTC
Shewanella sp ANA-3 Shewana3_3046 -109 3.9 AAAATCGATTTTGCTCACAGTA
Shewanella sp MR-4 Shewmr4_2868 -109 4 AAAATCGATTTTGCTCACACTA
Shewanella sp MR-7 Shewmr7_2950 -109 4 AAAATCGATTTTGCTCACACAA
Shewanella loihica PV-4 Shew_1035 -110 3.8 TTTTGGGCAGCGCTTCACACTT
Shewanella pealeana ATCC 700345 Spea_1016 -89 4.8 ATTTTTGATTCAGTTCACAAAC
Shewanella halifaxensis HAW-EB4 Shal_1064 -89 4.6 ATTTTTGATTCAGTTCACAGTC
Shewanella woodyi ATCC 51908 Swoo_1224 -111 4.3 ATTTTAGAGATAGCTCACATTT
Position: -55
Score: 4.3
Sequence: AATAGTGATTTTTATTGCAAAT
Locus tag: Shewmr4_2871
Shewmr4_2871 -55 4.3 AATAGTGATTTTTATTGCAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Shewmr4_2871
Ortholog function: hypothetical protein
Shewanella sp MR-4 Shewmr4_2871 -55 4.3 AATAGTGATTTTTATTGCAAAT
Shewanella sp MR-7 Shewmr7_2953 -55 4.3 AATAGTGATTTTTATTGCAAAT
Position: -60
Score: 4.1
Sequence: AAAAATGAACTAGATCAAAATA
Locus tag: Shewmr4_2909
Shewmr4_2909 -60 4.1 AAAAATGAACTAGATCAAAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1278
Ortholog function: methyl-accepting chemotaxis protein
Shewanella oneidensis MR-1 SO1278 -297 4.4 CATTGTGAGTTGAGTCATATTT
-189 4 TAATGGGAGCGTCATCACACTC
-57 4.1 TAAAATGAACTAGATCAAAATA
Shewanella sp ANA-3 Shewana3_3088 -217 4.1 TTTCGCGATAAATATCAAACTT
-60 4.1 AAAAATGAACTAGATCAAAATA
Shewanella sp MR-4 Shewmr4_2909 -249 3.7 TATTGTGAGTTAGGTCATGTCG
-60 4.1 AAAAATGAACTAGATCAAAATA
Shewanella sp MR-7 Shewmr7_2991 -249 3.7 TATTGTGAGTTAGGTCATGTCG
-60 4.1 AAAAATGAACTAGATCAAAATA
Position: -49
Score: 4.5
Sequence: TTTTTTGAGATGAATCACCTAA
Locus tag: Shewmr4_2959
Shewmr4_2959 -49 4.5 TTTTTTGAGATGAATCACCTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mviN
Ortholog function: proposed peptidoglycan lipid II flippase MurJ
Shewanella oneidensis MR-1 SO3534 -49 4.5 TTTTTTGAGATGAATCACCTAA
Shewanella putrefaciens CN-32 Sputcn32_1057 -49 4.5 TTTTTTGAGATGAATCACCTAA
Shewanella sp W3-18-1 Sputw3181_3108 -49 4.5 TTTTTTGAGATGAATCACCTAA
Shewanella sp ANA-3 Shewana3_3138 -49 4.5 TTTTTTGAGATGAATCACCTAA
Shewanella sp MR-4 Shewmr4_2959 -49 4.5 TTTTTTGAGATGAATCACCTAA
Shewanella sp MR-7 Shewmr7_3041 -49 4.5 TTTTTTGAGATGAATCACCTAA
Shewanella baltica OS155 Sbal_1052 -49 4.6 TTTTTTGAGATGTATCACCTAA
Shewanella amazonensis SB2B Sama_0922 -138 3.9 TATTGTTACTGGCAGCAAACAA
Position: -225
Score: 4.5
Sequence: TTAGGTGATTCATCTCAAAAAA
Locus tag: Shewmr4_2960
Shewmr4_2960 -225 4.5 TTAGGTGATTCATCTCAAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rpsT
Ortholog function: SSU ribosomal protein S20p
Shewanella oneidensis MR-1 SO3537 -225 4.5 TTAGGTGATTCATCTCAAAAAA
Shewanella putrefaciens CN-32 Sputcn32_1056 -225 4.5 TTAGGTGATTCATCTCAAAAAA
Shewanella sp W3-18-1 Sputw3181_3109 -225 4.5 TTAGGTGATTCATCTCAAAAAA
Shewanella sp MR-4 Shewmr4_2960 -225 4.5 TTAGGTGATTCATCTCAAAAAA
Shewanella sp MR-7 Shewmr7_3042 -225 4.5 TTAGGTGATTCATCTCAAAAAA
Shewanella baltica OS155 Sbal_1051 -225 4.5 TTAGGTGATACATCTCAAAAAA
Position: -95
Score: 4.3
Sequence: AATTTGGATGTAGAACACATTT
Locus tag: Shewmr4_2965
Shewmr4_2965 -95 4.3 AATTTGGATGTAGAACACATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: phk
Ortholog function: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9)
Shewanella oneidensis MR-1 SO3542 -95 4.2 AATTTGGATGCAGAACACATTT
Shewanella putrefaciens CN-32 Sputcn32_1051 -234 4 TCATGTGATCAAGCCTACATTT
-95 4.1 AATTTGGATGTAGGGCACATTT
Shewanella sp W3-18-1 Sputw3181_3114 -234 4 TCATGTGATCAAGCCTACATTT
-95 4.1 AATTTGGATGTAGGGCACATTT
Shewanella sp ANA-3 Shewana3_3145 -95 4 AATTTGGATGCAGGGCACATTT
Shewanella sp MR-4 Shewmr4_2965 -95 4.3 AATTTGGATGTAGAACACATTT
Shewanella sp MR-7 Shewmr7_3047 -95 4.3 AATTTGGATGTAGAACACATTT
Shewanella baltica OS155 Sbal_1046 -235 4.4 TCATGTGATCAAGCTCGCGTTT
-96 4.1 AATTTGGATGTAGGGCACATTT
Shewanella denitrificans OS217 Sden_2731 -233 5 CTTAGTGATCCAGTTCACATTA
-94 3.7 AAGTTAGATCGGGGACACATTT
Shewanella frigidimarina NCIMB 400 Sfri_2898 -233 4.5 ACAAGTGATATCCATCACACTT
-95 3.8 AAATTAGATAAAGGCCACATTA
Shewanella amazonensis SB2B Sama_0915 -240 4.1 ACTCGTGATCAAGCTCACGGTT
-99 4.1 AATTTGGATGTGGGGCACATTT
Shewanella loihica PV-4 Shew_1091 -238 4.6 CCATGTGATACAGATCACAGTT
-97 4 AAATAAGATATTGAACACATTT
Shewanella pealeana ATCC 700345 Spea_1076 -235 3.9 CTGAGCGATATAGATCACAGTT
Shewanella halifaxensis HAW-EB4 Shal_1124 -56 4.3 TATAGTGAGTTATATAAAATTT
Shewanella piezotolerans WP3 swp_3738 -237 4.5 CTGAGTGATACAGATCACACAT
-96 3.8 AAATAAGATACAGGACACATTT
Shewanella sediminis HAW-EB3 Ssed_1186 -238 4.4 CCATGTGACGCAGATCACAGTT
-97 4.2 AAATAAGATGTAGAACACATTT
Shewanella woodyi ATCC 51908 Swoo_1282 -238 4.4 TCGCGTGATCACGATCACACTT
-97 3.8 AAACAAGATATAGAACACATTT
Position: -165
Score: 4.4
Sequence: TTGTGTGATCATAGTTACAAAA
Locus tag: Shewmr4_2973
Shewmr4_2973 -165 4.4 TTGTGTGATCATAGTTACAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3552
Ortholog function: Von Willebrand factor type A domain protein
Shewanella oneidensis MR-1 SO3552 -152 4.1 TTGTGTGATCATAGTTGCAAAA
Shewanella putrefaciens CN-32 Sputcn32_1043 -143 4 CTGTGTGATCATGATTGCAAAT
Shewanella sp W3-18-1 Sputw3181_3122 -143 4 CTGTGTGATCATGATTGCAAAT
Shewanella sp ANA-3 Shewana3_3153 -165 4.1 TTGTGTGATCATAGTTGCAAAA
Shewanella sp MR-4 Shewmr4_2973 -165 4.4 TTGTGTGATCATAGTTACAAAA
Shewanella sp MR-7 Shewmr7_3055 -165 4.4 TTGTGTGATCATAGTTACAAAA
Shewanella baltica OS155 Sbal_1038 -126 3.8 CAGTGTGATCTTGTCAGCAAAA
Position: -70
Score: 4.5
Sequence: TTTTGTAACTATGATCACACAA
Locus tag: Shewmr4_2974
Shewmr4_2974 -70 4.5 TTTTGTAACTATGATCACACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3553
Ortholog function: putative sulfate permease
Shewanella oneidensis MR-1 SO3553 -70 3.9 TTTTGCAACTATGATCACACAA
Shewanella oneidensis MR-1 SO3553 -70 3.9 TTTTGCAACTATGATCACACAA
Shewanella oneidensis MR-1 SO3553 -70 3.9 TTTTGCAACTATGATCACACAA
Shewanella putrefaciens CN-32 Sputcn32_1042 -81 4 ATTTGCAATCATGATCACACAG
Shewanella putrefaciens CN-32 Sputcn32_1042 -81 4 ATTTGCAATCATGATCACACAG
Shewanella putrefaciens CN-32 Sputcn32_1042 -81 4 ATTTGCAATCATGATCACACAG
Shewanella sp W3-18-1 Sputw3181_3123 -81 4 ATTTGCAATCATGATCACACAG
Shewanella sp W3-18-1 Sputw3181_3123 -81 4 ATTTGCAATCATGATCACACAG
Shewanella sp W3-18-1 Sputw3181_3123 -81 4 ATTTGCAATCATGATCACACAG
Shewanella sp ANA-3 Shewana3_3154 -70 3.9 TTTTGCAACTATGATCACACAA
Shewanella sp ANA-3 Shewana3_3154 -70 3.9 TTTTGCAACTATGATCACACAA
Shewanella sp ANA-3 Shewana3_3154 -70 3.9 TTTTGCAACTATGATCACACAA
Shewanella sp MR-4 Shewmr4_2974 -70 4.5 TTTTGTAACTATGATCACACAA
Shewanella sp MR-4 Shewmr4_2974 -70 4.5 TTTTGTAACTATGATCACACAA
Shewanella sp MR-4 Shewmr4_2974 -70 4.5 TTTTGTAACTATGATCACACAA
Shewanella sp MR-7 Shewmr7_3056 -70 4.5 TTTTGTAACTATGATCACACAA
Shewanella sp MR-7 Shewmr7_3056 -70 4.5 TTTTGTAACTATGATCACACAA
Shewanella sp MR-7 Shewmr7_3056 -70 4.5 TTTTGTAACTATGATCACACAA
Shewanella baltica OS155 Sbal_1037 -139 3.8 TGATATGAAATTGTTCGCAGTT
-95 4.1 TTTCGTTATATACTTAACAGAA
Shewanella frigidimarina NCIMB 400 Sfri_3674 -116 4.5 TAATGTGATGATAATTATATTA
Shewanella frigidimarina NCIMB 400 Sfri_3674 -116 4.5 TAATGTGATGATAATTATATTA
Shewanella frigidimarina NCIMB 400 Sfri_3674 -116 4.5 TAATGTGATGATAATTATATTA
Shewanella amazonensis SB2B Sama_1067 -82 4.1 AAATTTGCCAAAGCTCACACAT
Shewanella amazonensis SB2B Sama_1067 -82 4.1 AAATTTGCCAAAGCTCACACAT
Shewanella amazonensis SB2B Sama_1067 -82 4.1 AAATTTGCCAAAGCTCACACAT
Shewanella sediminis HAW-EB3 Ssed_1334 -233 4.1 GTAAGTGCTACGCATCACATTT
Shewanella sediminis HAW-EB3 Ssed_1334 -233 4.1 GTAAGTGCTACGCATCACATTT
Shewanella sediminis HAW-EB3 Ssed_1334 -233 4.1 GTAAGTGCTACGCATCACATTT
Shewanella woodyi ATCC 51908 Swoo_3320 -288 3.7 TCCAGCGACTTAGATCACATTT
Shewanella woodyi ATCC 51908 Swoo_3320 -288 3.7 TCCAGCGACTTAGATCACATTT
Position: -292
Score: 3.8
Sequence: AAGTTTGAACCTTAGCAAAATT
Locus tag: Shewmr4_3002
Shewmr4_3002 -292 3.8 AAGTTTGAACCTTAGCAAAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO3588
Ortholog function: gpr1/fun34/yaaH family protein
Shewanella putrefaciens CN-32 Sputcn32_1014 -312 4.1 AATTTTGAACCAATGCAAATAT
-44 4.3 TATTTTGATTTTAATCAATTTA
Shewanella sp W3-18-1 Sputw3181_3151 -312 4.1 AATTTTGAACCAATGCAAATAT
-44 4.3 TATTTTGATTTTAATCAATTTA
Shewanella sp ANA-3 Shewana3_3180 -117 4.2 TATTTTGATTGTGATCTCTTTA
Shewanella sp MR-4 Shewmr4_3002 -292 3.8 AAGTTTGAACCTTAGCAAAATT
Shewanella sp MR-7 Shewmr7_3083 -292 3.8 AAGTTTGAACCTTAGCAAAATT
Shewanella frigidimarina NCIMB 400 Sfri_3630 -313 3.8 TTTTGAGACTTATCACACCAAT
Shewanella loihica PV-4 Shew_0904 -97 4.4 TATTGTGATGCCCTTAAGACTT
Shewanella pealeana ATCC 700345 Spea_0890 -246 3.8 TGGCGTGACGTGTGTCACTCTT
Shewanella woodyi ATCC 51908 Swoo_1050 -309 3.9 TTGTGTGATAAGGGTCTTGTTT
-206 3.9 TTATGTGATGAATGATTCATTT
Position: -121
Score: 3.9
Sequence: TAGCTTGATCGAAAACACAGTT
Locus tag: Shewmr4_3020
Shewmr4_3020 -121 3.9 TAGCTTGATCGAAAACACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: purT
Ortholog function: phosphoribosylglycinamide formyltransferase 2 (EC 2.1.2.-)
Shewanella oneidensis MR-1 SO3613 -161 3.8 TAGCTTGATCAAAAACACAGTT
Shewanella putrefaciens CN-32 Sputcn32_1001 -119 3.8 TAGCTTGATCAAAAACACAGTT
Shewanella sp W3-18-1 Sputw3181_3164 -119 3.8 TAGCTTGATCAAAAACACAGTT
Shewanella sp ANA-3 Shewana3_3197 -121 3.9 TAGCTTGATCGAAAACACAGTT
Shewanella sp MR-4 Shewmr4_3020 -121 3.9 TAGCTTGATCGAAAACACAGTT
Shewanella sp MR-7 Shewmr7_3101 -121 3.9 TAGCTTGATCGAAAACACAGTT
Shewanella pealeana ATCC 700345 Spea_0871 -176 4.4 AAGAGTGATCTCGCCCACACTT
Shewanella halifaxensis HAW-EB4 Shal_0924 -169 4.5 AGTAGTGATCTCGTGCACACAT
Shewanella piezotolerans WP3 swp_4077 -147 4.1 CAGCGTGATCTGCCGCACGTTT
Shewanella sediminis HAW-EB3 Ssed_0973 -160 4.6 TAAAGTGATCCACTACACACTT
Position: -120
Score: 4.4
Sequence: TAGAGTGAGATTAATCACAGTT
Locus tag: Shewmr4_3034
Shewmr4_3034 -120 4.4 TAGAGTGAGATTAATCACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fkpA
Ortholog function: FKBP-type peptidyl-prolyl cis-trans isomerase FkpA precursor (EC 5.2.1.8)
Shewanella oneidensis MR-1 SO1065 -119 4.3 TAGAGTGAAATTAATCACAGTT
Shewanella sp ANA-3 Shewana3_0903 -120 4.4 TAGAGTGAGATTAATCACAGTT
Shewanella sp MR-4 Shewmr4_3034 -120 4.4 TAGAGTGAGATTAATCACAGTT
Shewanella sp MR-7 Shewmr7_0940 -120 4.4 TAGAGTGAGATTAATCACAGTT
Shewanella halifaxensis HAW-EB4 Shal_0881 -99 4.1 TAATCTGATTGGAATAACCTAT
Shewanella sediminis HAW-EB3 Ssed_0918 -96 3.9 CAATGTAATTGGAATAACGTAT
Shewanella woodyi ATCC 51908 Swoo_0968 -95 4.2 TAATGTAATTGGAATATCATAT
Position: -56
Score: 4.3
Sequence: AACTGTGATTAATCTCACTCTA
Locus tag: Shewmr4_3035
Shewmr4_3035 -56 4.3 AACTGTGATTAATCTCACTCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO1064
Ortholog function: FOG: WD40 repeat
Shewanella sp MR-4 Shewmr4_3035 -56 4.3 AACTGTGATTAATCTCACTCTA
Shewanella sp MR-7 Shewmr7_0939 -56 4.3 AACTGTGATTAATCTCACTCTA
Position: -320
Score: 4.1
Sequence: TTTTGTGAGCAAGCTAGAATTA
Locus tag: Shewmr4_3066
Shewmr4_3066 -320 4.1 TTTTGTGAGCAAGCTAGAATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: hemG
Ortholog function: protoporphyrinogen IX oxidase, oxygen-independent, HemG (EC 1.3.-.-)
Shewanella putrefaciens CN-32 Sputcn32_3038 -207 4.5 TTTTGTGAGCAAGCTAAAATTA
-135 3.9 AATTGATATTTAAATCACCTAG
Shewanella sp W3-18-1 Sputw3181_0907 -207 4.5 TTTTGTGAGCAAGCTAAAATTA
-135 3.9 AATTGATATTTAAATCACCTAG
Shewanella sp ANA-3 Shewana3_0871 -317 4.1 TTTTGTGAGCAAGCTAGAATTA
Shewanella sp MR-4 Shewmr4_3066 -320 4.1 TTTTGTGAGCAAGCTAGAATTA
Shewanella sp MR-7 Shewmr7_0906 -318 4.1 TTTTGTGAGCAAGCTAGAATTA
Shewanella baltica OS155 Sbal_3400 -316 4.4 TTTTGTGAGACAGTTAAAACTA
Shewanella frigidimarina NCIMB 400 Sfri_0813 -144 4 TTTTGCGCGGCAGTTCACATTG
-83 4.4 TGACGTGATCTGTTTCATGTAA
Shewanella amazonensis SB2B Sama_2882 -130 3.9 AAATGTGAGGCAGTTGGAATTT
Shewanella loihica PV-4 Shew_0678 -126 4.1 ATTTGTGACATCGGTAAACTTA
Shewanella pealeana ATCC 700345 Spea_0673 -140 4 TTTTGTGAGGTAGGTAAAGCTA
-98 3.8 CCTCGTGATCTGTTTCATGTAA
Shewanella halifaxensis HAW-EB4 Shal_3525 -139 4 TTTTGTGAGGTAGGTAAAGCTA
-97 3.8 CCTCGTGATCTGTTTCATGTAA
Shewanella piezotolerans WP3