Statistics of regulated genes

Genome	Genes	Operons
Shewanella oneidensis MR-1	10	5
Shewanella putrefaciens CN-32	11	5
Shewanella sp W3-18-1	11	5
Shewanella sp ANA-3	11	5
Shewanella sp MR-4	11	5
Shewanella sp MR-7	11	5
Shewanella baltica OS155	11	5
Shewanella denitrificans OS217	9	3
Shewanella frigidimarina NCIMB 400	10	4
Shewanella amazonensis SB2B	11	5
Shewanella loihica PV-4	11	5
Shewanella pealeana ATCC 700345	11	5
Shewanella halifaxensis HAW-EB4	11	5
Shewanella piezotolerans WP3	11	5
Shewanella sediminis HAW-EB3	11	5
Shewanella woodyi ATCC 51908	10	4

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																	Function
CRON 1.
ygbA	* Shewanella oneidensis MR-1 Site: position = -29 score = 4.09269 sequence = TTATCCGAGTCACAGACTAAGGTAT Gene: SO_0324: hypothetical protein involved in nitrosative stress	* Shewanella putrefaciens CN-32 Site: position = -29 score = 4.87701 sequence = ATATCCGAGTAACTGACTAAGGTAT Gene: Sputcn32_3663: hypothetical protein involved in nitrosative stress	* Shewanella sp W3-18-1 Site: position = -29 score = 4.87701 sequence = ATATCCGAGTAACTGACTAAGGTAT Gene: Sputw3181_3804: hypothetical protein involved in nitrosative stress	* Shewanella sp ANA-3 Site: position = -29 score = 4.44894 sequence = TTATCCGAGTGACAGACTAAGGTAT Gene: Shewana3_3845: hypothetical protein involved in nitrosative stress	* Shewanella sp MR-4 Site: position = -29 score = 4.44894 sequence = TTATCCGAGTGACAGACTAAGGTAT Gene: Shewmr4_3649: hypothetical protein involved in nitrosative stress	* Shewanella sp MR-7 Site: position = -29 score = 4.44894 sequence = TTATCCGAGTGACAGACTAAGGTAT Gene: Shewmr7_0295: hypothetical protein involved in nitrosative stress	* Shewanella baltica OS155 Site: position = -29 score = 4.52745 sequence = ATATCCGAGTGACAAGCTAAGGTAT Gene: Sbal_4067: hypothetical protein involved in nitrosative stress	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -43 score = 5.57281 sequence = ATATCCGACTGTTTTACTAAGGTAT Gene: Sfri_0404: hypothetical protein involved in nitrosative stress	* Shewanella amazonensis SB2B Site: position = -30 score = 5.12049 sequence = AAAACCAAGTAAATTACTTGGGTAT Gene: Sama_3326: hypothetical protein involved in nitrosative stress	* Shewanella loihica PV-4 Site: position = -28 score = 4.83325 sequence = ATAACCCAGTAAAGAAGTCAGATAT Gene: Shew_0259: hypothetical protein involved in nitrosative stress	* Shewanella pealeana ATCC 700345 Site: position = -28 score = 5.02174 sequence = ATAACCAAGTAGCTTACTAAGGTAT Gene: Spea_0303: hypothetical protein involved in nitrosative stress	* Shewanella halifaxensis HAW-EB4 Site: position = -28 score = 5.12765 sequence = ATAACCCAGTAACTTACTAAGGTAT Gene: Shal_3986: hypothetical protein involved in nitrosative stress	* Shewanella piezotolerans WP3 Site: position = -28 score = 4.77666 sequence = ATAACCCAGTGGCTTACTAAGGTAT Gene: swp_2171: hypothetical protein involved in nitrosative stress	* Shewanella sediminis HAW-EB3 Site: position = -125 score = 5.36272 sequence = GTACCTTAGTAATTTACTAGGGTAT Gene: Ssed_4199: hypothetical protein involved in nitrosative stress	Shewanella woodyi ATCC 51908 Gene: Swoo_0395: hypothetical protein involved in nitrosative stress	hypothetical protein involved in nitrosative stress
CRON 2.
iscR	* Shewanella oneidensis MR-1 Site: position = -90 score = 5.48351 sequence = ATACTTGAGTGATTTACTAGGTTTT Site: position = -65 score = 6.36439 sequence = ATACTTGACTGATTTACTCGGGTAT Gene: SO_2263: Iron-sulfur cluster regulator IscR	* Shewanella putrefaciens CN-32 Site: position = -66 score = 6.44897 sequence = ATACTTGACTAATTTACTCGGGTAT Site: position = -91 score = 4.30123 sequence = TTACCTGAGTGTTTTAGTAGGACTT Gene: Sputcn32_2150: Iron-sulfur cluster regulator IscR	* Shewanella sp W3-18-1 Site: position = -91 score = 4.30123 sequence = TTACCTGAGTGTTTTAGTAGGACTT Site: position = -66 score = 6.44897 sequence = ATACTTGACTAATTTACTCGGGTAT Gene: Sputw3181_1861: Iron-sulfur cluster regulator IscR	* Shewanella sp ANA-3 Site: position = -90 score = 5.38559 sequence = ATACCTGAGTGTTTTACTAGGTTTT Site: position = -65 score = 6.273 sequence = ATACTTGACTGAAATACTCGGGTAT Gene: Shewana3_2281: Iron-sulfur cluster regulator IscR	* Shewanella sp MR-4 Site: position = -90 score = 5.59506 sequence = ATACTTGAGTATTTTACTAGGGTTT Site: position = -65 score = 6.36439 sequence = ATACTTGACTGAATTACTCGGGTAT Gene: Shewmr4_1738: Iron-sulfur cluster regulator IscR	* Shewanella sp MR-7 Site: position = -90 score = 5.39212 sequence = ATACTTGAGTGTTTTACTAGGTTTT Site: position = -65 score = 6.36059 sequence = ATACTTGACTGAAATACTCAGGTAT Gene: Shewmr7_1818: Iron-sulfur cluster regulator IscR	* Shewanella baltica OS155 Site: position = -90 score = 5.41491 sequence = ATACTTGAGTGTTTTAGTAGGTTTT Site: position = -64 score = 6.36439 sequence = ATACTTGACTGATTTACTCGGGTAT Gene: Sbal_2398: Iron-sulfur cluster regulator IscR	* Shewanella denitrificans OS217 Site: position = -88 score = 5.14002 sequence = ATACTTGAGTAAAACACTAGGTTTA Site: position = -63 score = 6.44897 sequence = ATACTTGACTAAATTACTCGGGTAT Gene: Sden_1457: Iron-sulfur cluster regulator IscR	* Shewanella frigidimarina NCIMB 400 Site: position = -89 score = 4.51876 sequence = ATACCCGAGTGTTTTGGTAGGATTA Site: position = -64 score = 6.16346 sequence = ATACTTGACTAAATTACTAGGGTAT Gene: Sfri_2425: Iron-sulfur cluster regulator IscR	* Shewanella amazonensis SB2B Site: position = -91 score = 5.55689 sequence = ATACTTGAGTAAATTAGTTGGTTTT Site: position = -66 score = 6.46941 sequence = ATAGTTGACTAAATTACTCAGGTAT Gene: Sama_1292: Iron-sulfur cluster regulator IscR	* Shewanella loihica PV-4 Site: position = -65 score = 6.38991 sequence = ATACTTGACTAAAACAGTCAAGTAT Site: position = -90 score = 5.05782 sequence = ATACCTGACTAATCTGCTAGGTTTT Gene: Shew_2318: Iron-sulfur cluster regulator IscR	* Shewanella pealeana ATCC 700345 Site: position = -65 score = 6.38037 sequence = ATACTTGACTAAAATAGTCGGGTAT Site: position = -90 score = 5.03724 sequence = ATACTTGACCGAATTGCTAGGCTTT Gene: Spea_1487: Iron-sulfur cluster regulator IscR	* Shewanella halifaxensis HAW-EB4 Site: position = -90 score = 4.50889 sequence = ATACCTGACCAAATAGCTAGGCTTA Site: position = -65 score = 5.95108 sequence = ATACTTGACTGAAACGGTCGGGTAT Gene: Shal_1571: Iron-sulfur cluster regulator IscR	* Shewanella piezotolerans WP3 Site: position = -90 score = 5.1819 sequence = ATACTTGACCAAACCACTAGGTTAA Site: position = -65 score = 6.53656 sequence = ATACTTGACTAAATTACTCAGGTAT Gene: swp_1693: Iron-sulfur cluster regulator IscR	* Shewanella sediminis HAW-EB3 Site: position = -161 score = 4.46036 sequence = ATACCCCACCAAAGTGGCAGGGTAT Site: position = -63 score = 6.38037 sequence = ATACTTGACTAAAATAGTCGGGTAT Gene: Ssed_2872: Iron-sulfur cluster regulator IscR	* Shewanella woodyi ATCC 51908 Site: position = -215 score = 4.10821 sequence = TTTCGTGAGTATTATGGTAAAGATT Site: position = -90 score = 5.07237 sequence = ATACTTGACTAAACTACTAGGTTTA Site: position = -65 score = 6.36059 sequence = ATACTTGACTAAAACACTCAGGTAT Gene: Swoo_1775: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
iscS	Shewanella oneidensis MR-1 Gene: SO_2264: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella putrefaciens CN-32 Gene: Sputcn32_2149: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella sp W3-18-1 Gene: Sputw3181_1862: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella sp ANA-3 Gene: Shewana3_2280: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella sp MR-4 Gene: Shewmr4_1739: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella sp MR-7 Gene: Shewmr7_1819: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella baltica OS155 Gene: Sbal_2397: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella denitrificans OS217 Gene: Sden_1458: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2424: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella amazonensis SB2B Gene: Sama_1293: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella loihica PV-4 Gene: Shew_2317: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella pealeana ATCC 700345 Gene: Spea_1488: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella halifaxensis HAW-EB4 Gene: Shal_1572: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella piezotolerans WP3 Gene: swp_1694: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella sediminis HAW-EB3 Gene: Ssed_2871: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Shewanella woodyi ATCC 51908 Gene: Swoo_1776: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Shewanella oneidensis MR-1 Gene: SO_2265: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella putrefaciens CN-32 Gene: Sputcn32_2148: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella sp W3-18-1 Gene: Sputw3181_1863: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella sp ANA-3 Gene: Shewana3_2279: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella sp MR-4 Gene: Shewmr4_1740: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella sp MR-7 Gene: Shewmr7_1820: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella baltica OS155 Gene: Sbal_2396: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella denitrificans OS217 Gene: Sden_1459: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2423: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella amazonensis SB2B Gene: Sama_1294: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella loihica PV-4 Gene: Shew_2316: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella pealeana ATCC 700345 Gene: Spea_1489: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella halifaxensis HAW-EB4 Gene: Shal_1573: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella piezotolerans WP3 Gene: swp_1695: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella sediminis HAW-EB3 Gene: Ssed_2870: Iron-sulfur cluster assembly scaffold protein IscU	Shewanella woodyi ATCC 51908 Gene: Swoo_1777: Iron-sulfur cluster assembly scaffold protein IscU	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Shewanella oneidensis MR-1 Gene: SO_2266: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella putrefaciens CN-32 Gene: Sputcn32_2147: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella sp W3-18-1 Gene: Sputw3181_1864: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella sp ANA-3 Gene: Shewana3_2278: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella sp MR-4 Gene: Shewmr4_1741: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella sp MR-7 Gene: Shewmr7_1821: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella baltica OS155 Gene: Sbal_2395: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella denitrificans OS217 Gene: Sden_1460: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2422: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella amazonensis SB2B Gene: Sama_1295: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella loihica PV-4 Gene: Shew_2315: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella pealeana ATCC 700345 Gene: Spea_1490: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella halifaxensis HAW-EB4 Gene: Shal_1574: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella piezotolerans WP3 Gene: swp_1697: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella sediminis HAW-EB3 Gene: Ssed_2869: Iron binding protein IscA for iron-sulfur cluster assembly	Shewanella woodyi ATCC 51908 Gene: Swoo_1778: Iron binding protein IscA for iron-sulfur cluster assembly	Iron binding protein IscA for iron-sulfur cluster assembly
hscB	Shewanella oneidensis MR-1 Gene: SO_2267: Chaperone protein HscB	Shewanella putrefaciens CN-32 Gene: Sputcn32_2146: Chaperone protein HscB	Shewanella sp W3-18-1 Gene: Sputw3181_1865: Chaperone protein HscB	Shewanella sp ANA-3 Gene: Shewana3_2277: Chaperone protein HscB	Shewanella sp MR-4 Gene: Shewmr4_1742: Chaperone protein HscB	Shewanella sp MR-7 Gene: Shewmr7_1822: Chaperone protein HscB	Shewanella baltica OS155 Gene: Sbal_2394: Chaperone protein HscB	Shewanella denitrificans OS217 Gene: Sden_1461: Chaperone protein HscB	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2421: Chaperone protein HscB	Shewanella amazonensis SB2B Gene: Sama_1296: Chaperone protein HscB	Shewanella loihica PV-4 Gene: Shew_2314: Chaperone protein HscB	Shewanella pealeana ATCC 700345 Gene: Spea_1491: Chaperone protein HscB	Shewanella halifaxensis HAW-EB4 Gene: Shal_1575: Chaperone protein HscB	Shewanella piezotolerans WP3 Gene: swp_1698: Chaperone protein HscB	Shewanella sediminis HAW-EB3 Gene: Ssed_2868: Chaperone protein HscB	Shewanella woodyi ATCC 51908 Gene: Swoo_1779: Chaperone protein HscB	Chaperone protein HscB
hscA	Shewanella oneidensis MR-1 Gene: SO_2268: Chaperone protein HscA	Shewanella putrefaciens CN-32 Gene: Sputcn32_2145: Chaperone protein HscA	Shewanella sp W3-18-1 Gene: Sputw3181_1866: Chaperone protein HscA	Shewanella sp ANA-3 Gene: Shewana3_2276: Chaperone protein HscA	Shewanella sp MR-4 Gene: Shewmr4_1743: Chaperone protein HscA	Shewanella sp MR-7 Gene: Shewmr7_1823: Chaperone protein HscA	Shewanella baltica OS155 Gene: Sbal_2393: Chaperone protein HscA	Shewanella denitrificans OS217 Gene: Sden_1462: Chaperone protein HscA	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2420: Chaperone protein HscA	Shewanella amazonensis SB2B Gene: Sama_1297: Chaperone protein HscA	Shewanella loihica PV-4 Gene: Shew_2313: Chaperone protein HscA	Shewanella pealeana ATCC 700345 Gene: Spea_1492: Chaperone protein HscA	Shewanella halifaxensis HAW-EB4 Gene: Shal_1576: Chaperone protein HscA	Shewanella piezotolerans WP3 Gene: swp_1699: Chaperone protein HscA	Shewanella sediminis HAW-EB3 Gene: Ssed_2867: Chaperone protein HscA	Shewanella woodyi ATCC 51908 Gene: Swoo_1780: Chaperone protein HscA	Chaperone protein HscA
fdx	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32 Gene: Sputcn32_2144: ferredoxin, 2Fe-2S type, ISC system	Shewanella sp W3-18-1 Gene: Sputw3181_1867: ferredoxin, 2Fe-2S type, ISC system	Shewanella sp ANA-3 Gene: Shewana3_2275: ferredoxin, 2Fe-2S type, ISC system	Shewanella sp MR-4 Gene: Shewmr4_1744: ferredoxin, 2Fe-2S type, ISC system	Shewanella sp MR-7 Gene: Shewmr7_1824: ferredoxin, 2Fe-2S type, ISC system	Shewanella baltica OS155 Gene: Sbal_2392: ferredoxin, 2Fe-2S type, ISC system	Shewanella denitrificans OS217 Gene: Sden_1463: ferredoxin, 2Fe-2S type, ISC system	Shewanella frigidimarina NCIMB 400 Gene: Sfri_2419: ferredoxin, 2Fe-2S type, ISC system	Shewanella amazonensis SB2B Gene: Sama_1298: ferredoxin, 2Fe-2S type, ISC system	Shewanella loihica PV-4 Gene: Shew_2312: ferredoxin, 2Fe-2S type, ISC system	Shewanella pealeana ATCC 700345 Gene: Spea_1493: ferredoxin, 2Fe-2S type, ISC system	Shewanella halifaxensis HAW-EB4 Gene: Shal_1577: ferredoxin, 2Fe-2S type, ISC system	Shewanella piezotolerans WP3 Gene: swp_1700: ferredoxin, 2Fe-2S type, ISC system	Shewanella sediminis HAW-EB3 Gene: Ssed_2866: ferredoxin, 2Fe-2S type, ISC system	Shewanella woodyi ATCC 51908 Gene: Swoo_1781: ferredoxin, 2Fe-2S type, ISC system	ferredoxin, 2Fe-2S type, ISC system
CRON 3.
nfuA	* Shewanella oneidensis MR-1 Site: position = -46 score = 4.95215 sequence = AATTCTTACTAAAACACTCAGGTAT Gene: SO_4619: NfuA Fe-S protein maturation	* Shewanella putrefaciens CN-32 Site: position = -46 score = 4.95215 sequence = AATTCTTACTAAAACACTCAGGTAT Gene: Sputcn32_3794: NfuA Fe-S protein maturation	* Shewanella sp W3-18-1 Site: position = -46 score = 4.95215 sequence = AATTCTTACTAAAACACTCAGGTAT Gene: Sputw3181_0119: NfuA Fe-S protein maturation	* Shewanella sp ANA-3 Site: position = -46 score = 4.95215 sequence = AATTCTTACTAAAACACTCAGGTAT Gene: Shewana3_4003: NfuA Fe-S protein maturation	* Shewanella sp MR-4 Site: position = -46 score = 4.95215 sequence = AATTCTTACTAAAACACTCAGGTAT Gene: Shewmr4_3804: NfuA Fe-S protein maturation	* Shewanella sp MR-7 Site: position = -46 score = 4.95215 sequence = AATTCTTACTAAAACACTCAGGTAT Gene: Shewmr7_3880: NfuA Fe-S protein maturation	* Shewanella baltica OS155 Site: position = -46 score = 4.95215 sequence = AATTCTTACTAAAACACTCAGGTAT Gene: Sbal_0142: NfuA Fe-S protein maturation	* Shewanella denitrificans OS217 Site: position = -46 score = 5.35046 sequence = GTATCTTACTAAATTACTCAGGTAT Gene: Sden_3528: NfuA Fe-S protein maturation	* Shewanella frigidimarina NCIMB 400 Site: position = -46 score = 5.12812 sequence = AATTCTTACTAATTTACTCAGGTAT Gene: Sfri_0244: NfuA Fe-S protein maturation	* Shewanella amazonensis SB2B Site: position = -44 score = 4.6511 sequence = AATTCTTAGTAATTTACTCAGGTTT Gene: Sama_3502: NfuA Fe-S protein maturation	* Shewanella loihica PV-4 Site: position = -46 score = 4.50171 sequence = AATTCTTACTAAATCACTCGGGTTT Gene: Shew_0106: NfuA Fe-S protein maturation	* Shewanella pealeana ATCC 700345 Site: position = -47 score = 4.49791 sequence = AATTCTTACTAAAACACTCAGGTTT Gene: Spea_4010: NfuA Fe-S protein maturation	* Shewanella halifaxensis HAW-EB4 Site: position = -47 score = 4.49791 sequence = AATTCTTACTAAAACACTCAGGTTT Gene: Shal_0247: NfuA Fe-S protein maturation	* Shewanella piezotolerans WP3 Site: position = -48 score = 4.49791 sequence = AATTCTTACTAAAACACTCAGGTTT Gene: swp_4841: NfuA Fe-S protein maturation	* Shewanella sediminis HAW-EB3 Site: position = -47 score = 4.27558 sequence = AATCCATACTAAAACACTCAAGCAT Gene: Ssed_0179: NfuA Fe-S protein maturation	* Shewanella woodyi ATCC 51908 Site: position = -46 score = 4.38659 sequence = AATCCATACTAAAACACTCAAGTTT Gene: Swoo_0159: NfuA Fe-S protein maturation	NfuA Fe-S protein maturation
CRON 4.
dnrN	* Shewanella oneidensis MR-1 Site: position = -167 score = 5.05799 sequence = AATCTTGACTATTTTAGTCAAGATT Gene: SO_4302: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella putrefaciens CN-32 Site: position = -90 score = 5.55822 sequence = ATTCCTGAGTGTTTTAGTCGGGTTT Gene: Sputcn32_3576: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sp W3-18-1 Site: position = -90 score = 5.55822 sequence = ATTCCTGAGTGTTTTAGTCGGGTTT Gene: Sputw3181_3715: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sp ANA-3 Site: position = -90 score = 5.19173 sequence = ATGCCCGACTAATTTAGTCAGGATT Gene: Shewana3_0397: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sp MR-4 Site: position = -90 score = 5.19173 sequence = ATGCCCGACTAATTTAGTCAGGATT Gene: Shewmr4_0398: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sp MR-7 Site: position = -90 score = 5.19173 sequence = ATGCCCGACTAATTTAGTCAGGATT Gene: Shewmr7_3627: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella baltica OS155 Site: position = -89 score = 5.18857 sequence = AATCCTGAGTATTTTAGTCGGGTTT Gene: Sbal_3989: Nitric oxide-dependent regulator DnrN or NorA	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0450: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella amazonensis SB2B Site: position = -87 score = 4.77 sequence = TTAACCCAGCAAAATACTCAAGTTT Gene: Sama_3236: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella loihica PV-4 Site: position = -99 score = 5.08773 sequence = AATCCCGAGTAAAACACTCAAGTTT Gene: Shew_0328: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella pealeana ATCC 700345 Site: position = -102 score = 5.79984 sequence = TTAACTGAGTATTTTACTCAAGTAA Gene: Spea_0383: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella halifaxensis HAW-EB4 Site: position = -104 score = 5.65806 sequence = TTACTTGAGCATTTTACTCAGGTAA Gene: Shal_3908: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella piezotolerans WP3 Site: position = -88 score = 5.50332 sequence = TTACCCGAGCATTTTACTCAACTAA Gene: swp_0412: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella sediminis HAW-EB3 Site: position = -98 score = 5.56819 sequence = ATTCCTGAGCAATTTAGTCAAGTTT Gene: Ssed_4124: Nitric oxide-dependent regulator DnrN or NorA	* Shewanella woodyi ATCC 51908 Site: position = -97 score = 5.38724 sequence = TTACCCTAGTGTTTTAGTCGGGAAT Gene: Swoo_0492: Nitric oxide-dependent regulator DnrN or NorA	Nitric oxide-dependent regulator DnrN or NorA
CRON 5.
erpA	* Shewanella oneidensis MR-1 Site: position = -88 score = 5.76328 sequence = ATACTTGAACAAAATAGTCAGGTAA Gene: SO_1304: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella putrefaciens CN-32 Site: position = -64 score = 5.76328 sequence = ATACTTGAACAAAATAGTCAGGTAA Gene: Sputcn32_1123: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella sp W3-18-1 Site: position = -64 score = 5.76328 sequence = ATACTTGAACAAAATAGTCAGGTAA Gene: Sputw3181_3041: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella sp ANA-3 Site: position = -64 score = 5.76328 sequence = ATACTTGAACAAAATAGTCAGGTAA Gene: Shewana3_3067: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella sp MR-4 Site: position = -64 score = 5.76328 sequence = ATACTTGAACAAAATAGTCAGGTAA Gene: Shewmr4_2889: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella sp MR-7 Site: position = -64 score = 5.76328 sequence = ATACTTGAACAAAATAGTCAGGTAA Gene: Shewmr7_2971: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella baltica OS155 Site: position = -64 score = 5.67869 sequence = ATACTTGAACAAAACAGTCAGGTAA Gene: Sbal_1163: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella denitrificans OS217 Site: position = -62 score = 5.76328 sequence = ATACTTGAACAAAATAGTCAGGTAA Gene: Sden_2815: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella frigidimarina NCIMB 400 Site: position = -63 score = 5.76328 sequence = ATACTTGAACAAAATAGTCAGGTAA Gene: Sfri_2976: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella amazonensis SB2B Site: position = -64 score = 5.76328 sequence = ATACTTGAACAAAATAGTCAGGTAA Gene: Sama_0843: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella loihica PV-4 Site: position = -64 score = 5.76328 sequence = TTACTTGAACAAAATAGTCAGGTAT Gene: Shew_1017: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella pealeana ATCC 700345 Site: position = -64 score = 5.65591 sequence = TTACTTGAACAAAACACTCAGGTAT Gene: Spea_0985: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella halifaxensis HAW-EB4 Site: position = -64 score = 5.65591 sequence = TTACTTGAACAAAACACTCAGGTAT Gene: Shal_1036: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella piezotolerans WP3 Site: position = -64 score = 5.41857 sequence = TTACTTGAACAAAACGGTCAGGTAT Gene: swp_3849: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella sediminis HAW-EB3 Site: position = -64 score = 5.50316 sequence = TTACTTGAACAAAATGGTCAGGTAT Gene: Ssed_1095: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Shewanella woodyi ATCC 51908 Site: position = -64 score = 5.75526 sequence = ATACTTGAACAAAATGGTCAGGTAT Gene: Swoo_1203: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD