Regulon of IscR in Shewanella loihica PV-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shew_2318
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 5.1 Sequence: ATACCTGACTAATCTGCTAGGTTTT Position: -65 Score: 6.4 Sequence: ATACTTGACTAAAACAGTCAAGTAT Locus tag: Shew_2318 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Shew_2317 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Shew_2316 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Shew_2315 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Shew_2314 Name: hscB Funciton: Chaperone protein HscB Locus tag: Shew_2313 Name: hscA Funciton: Chaperone protein HscA Locus tag: Shew_2312 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Shew_2318	iscR	Iron-sulfur cluster regulator IscR
	Shew_2317	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Shew_2316	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Shew_2315	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Shew_2314	hscB	Chaperone protein HscB
	Shew_2313	hscA	Chaperone protein HscA
	Shew_2312	fdx	ferredoxin, 2Fe-2S type, ISC system
Position: -46 Score: 4.5 Sequence: AATTCTTACTAAATCACTCGGGTTT Locus tag: Shew_0106 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Shew_0106	nfuA	NfuA Fe-S protein maturation
Position: -64 Score: 5.8 Sequence: TTACTTGAACAAAATAGTCAGGTAT Locus tag: Shew_1017 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Shew_1017	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -99 Score: 5.1 Sequence: AATCCCGAGTAAAACACTCAAGTTT Locus tag: Shew_0328 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Shew_0328	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -28 Score: 4.8 Sequence: ATAACCCAGTAAAGAAGTCAGATAT Locus tag: Shew_0259 Name: ygbA Funciton: hypothetical protein involved in nitrosative stress
	Shew_0259	ygbA	hypothetical protein involved in nitrosative stress

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD