Regulon of IscR in Shewanella putrefaciens CN-32

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputcn32_2150
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.8 Sequence: ATACTTGAACAAAATAGTCAGGTAA Locus tag: Sputcn32_1123 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Sputcn32_1123	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -90 Score: 5.6 Sequence: ATTCCTGAGTGTTTTAGTCGGGTTT Locus tag: Sputcn32_3576 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Sputcn32_3576	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -46 Score: 5 Sequence: AATTCTTACTAAAACACTCAGGTAT Locus tag: Sputcn32_3794 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Sputcn32_3794	nfuA	NfuA Fe-S protein maturation
Position: -29 Score: 4.9 Sequence: ATATCCGAGTAACTGACTAAGGTAT Locus tag: Sputcn32_3663 Name: ygbA Funciton: hypothetical protein involved in nitrosative stress
	Sputcn32_3663	ygbA	hypothetical protein involved in nitrosative stress
Position: -91 Score: 4.3 Sequence: TTACCTGAGTGTTTTAGTAGGACTT Position: -66 Score: 6.4 Sequence: ATACTTGACTAATTTACTCGGGTAT Locus tag: Sputcn32_2150 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Sputcn32_2149 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Sputcn32_2148 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Sputcn32_2147 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Sputcn32_2146 Name: hscB Funciton: Chaperone protein HscB Locus tag: Sputcn32_2145 Name: hscA Funciton: Chaperone protein HscA Locus tag: Sputcn32_2144 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Sputcn32_2150	iscR	Iron-sulfur cluster regulator IscR
	Sputcn32_2149	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Sputcn32_2148	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Sputcn32_2147	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Sputcn32_2146	hscB	Chaperone protein HscB
	Sputcn32_2145	hscA	Chaperone protein HscA
	Sputcn32_2144	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD