Regulon of IscR in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_1457
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 5.4 Sequence: GTATCTTACTAAATTACTCAGGTAT Locus tag: Sden_3528 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Sden_3528	nfuA	NfuA Fe-S protein maturation
Position: -62 Score: 5.8 Sequence: ATACTTGAACAAAATAGTCAGGTAA Locus tag: Sden_2815 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Sden_2815	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -88 Score: 5.1 Sequence: ATACTTGAGTAAAACACTAGGTTTA Position: -63 Score: 6.4 Sequence: ATACTTGACTAAATTACTCGGGTAT Locus tag: Sden_1457 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Sden_1458 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Sden_1459 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Sden_1460 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Sden_1461 Name: hscB Funciton: Chaperone protein HscB Locus tag: Sden_1462 Name: hscA Funciton: Chaperone protein HscA Locus tag: Sden_1463 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Sden_1457	iscR	Iron-sulfur cluster regulator IscR
	Sden_1458	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Sden_1459	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Sden_1460	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Sden_1461	hscB	Chaperone protein HscB
	Sden_1462	hscA	Chaperone protein HscA
	Sden_1463	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD