Regulon of IscR in Shewanella sediminis HAW-EB3

Properties
Regulator type:	Transcription factor
TF locus tag:	Ssed_2872
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.5 Sequence: TTACTTGAACAAAATGGTCAGGTAT Locus tag: Ssed_1095 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Ssed_1095	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -47 Score: 4.3 Sequence: AATCCATACTAAAACACTCAAGCAT Locus tag: Ssed_0179 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Ssed_0179	nfuA	NfuA Fe-S protein maturation
Position: -98 Score: 5.6 Sequence: ATTCCTGAGCAATTTAGTCAAGTTT Locus tag: Ssed_4124 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Ssed_4124	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -161 Score: 4.5 Sequence: ATACCCCACCAAAGTGGCAGGGTAT Position: -63 Score: 6.4 Sequence: ATACTTGACTAAAATAGTCGGGTAT Locus tag: Ssed_2872 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Ssed_2871 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Ssed_2870 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Ssed_2869 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Ssed_2868 Name: hscB Funciton: Chaperone protein HscB Locus tag: Ssed_2867 Name: hscA Funciton: Chaperone protein HscA Locus tag: Ssed_2866 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Ssed_2872	iscR	Iron-sulfur cluster regulator IscR
	Ssed_2871	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Ssed_2870	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Ssed_2869	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Ssed_2868	hscB	Chaperone protein HscB
	Ssed_2867	hscA	Chaperone protein HscA
	Ssed_2866	fdx	ferredoxin, 2Fe-2S type, ISC system
Position: -125 Score: 5.4 Sequence: GTACCTTAGTAATTTACTAGGGTAT Locus tag: Ssed_4199 Name: ygbA Funciton: hypothetical protein involved in nitrosative stress
	Ssed_4199	ygbA	hypothetical protein involved in nitrosative stress

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD