Regulon of IscR in Shewanella sp ANA-3

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewana3_2281
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.8 Sequence: ATACTTGAACAAAATAGTCAGGTAA Locus tag: Shewana3_3067 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Shewana3_3067	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -90 Score: 5.2 Sequence: ATGCCCGACTAATTTAGTCAGGATT Locus tag: Shewana3_0397 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Shewana3_0397	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -46 Score: 5 Sequence: AATTCTTACTAAAACACTCAGGTAT Locus tag: Shewana3_4003 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Shewana3_4003	nfuA	NfuA Fe-S protein maturation
Position: -29 Score: 4.4 Sequence: TTATCCGAGTGACAGACTAAGGTAT Locus tag: Shewana3_3845 Name: ygbA Funciton: hypothetical protein involved in nitrosative stress
	Shewana3_3845	ygbA	hypothetical protein involved in nitrosative stress
Position: -90 Score: 5.4 Sequence: ATACCTGAGTGTTTTACTAGGTTTT Position: -65 Score: 6.3 Sequence: ATACTTGACTGAAATACTCGGGTAT Locus tag: Shewana3_2281 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Shewana3_2280 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Shewana3_2279 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Shewana3_2278 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Shewana3_2277 Name: hscB Funciton: Chaperone protein HscB Locus tag: Shewana3_2276 Name: hscA Funciton: Chaperone protein HscA Locus tag: Shewana3_2275 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Shewana3_2281	iscR	Iron-sulfur cluster regulator IscR
	Shewana3_2280	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Shewana3_2279	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Shewana3_2278	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Shewana3_2277	hscB	Chaperone protein HscB
	Shewana3_2276	hscA	Chaperone protein HscA
	Shewana3_2275	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD