Regulon of IscR in Shewanella woodyi ATCC 51908

Properties
Regulator type:	Transcription factor
TF locus tag:	Swoo_1775
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.8 Sequence: ATACTTGAACAAAATGGTCAGGTAT Locus tag: Swoo_1203 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Swoo_1203	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -46 Score: 4.4 Sequence: AATCCATACTAAAACACTCAAGTTT Locus tag: Swoo_0159 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Swoo_0159	nfuA	NfuA Fe-S protein maturation
Position: -97 Score: 5.4 Sequence: TTACCCTAGTGTTTTAGTCGGGAAT Locus tag: Swoo_0492 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Swoo_0492	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -215 Score: 4.1 Sequence: TTTCGTGAGTATTATGGTAAAGATT Position: -90 Score: 5.1 Sequence: ATACTTGACTAAACTACTAGGTTTA Position: -65 Score: 6.4 Sequence: ATACTTGACTAAAACACTCAGGTAT Locus tag: Swoo_1775 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Swoo_1776 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Swoo_1777 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Swoo_1778 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Swoo_1779 Name: hscB Funciton: Chaperone protein HscB Locus tag: Swoo_1780 Name: hscA Funciton: Chaperone protein HscA Locus tag: Swoo_1781 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Swoo_1775	iscR	Iron-sulfur cluster regulator IscR
	Swoo_1776	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Swoo_1777	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Swoo_1778	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Swoo_1779	hscB	Chaperone protein HscB
	Swoo_1780	hscA	Chaperone protein HscA
	Swoo_1781	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD