Regulon of IscR in Shewanella halifaxensis HAW-EB4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shal_1571
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.7 Sequence: TTACTTGAACAAAACACTCAGGTAT Locus tag: Shal_1036 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Shal_1036	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -47 Score: 4.5 Sequence: AATTCTTACTAAAACACTCAGGTTT Locus tag: Shal_0247 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Shal_0247	nfuA	NfuA Fe-S protein maturation
Position: -104 Score: 5.7 Sequence: TTACTTGAGCATTTTACTCAGGTAA Locus tag: Shal_3908 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Shal_3908	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -90 Score: 4.5 Sequence: ATACCTGACCAAATAGCTAGGCTTA Position: -65 Score: 6 Sequence: ATACTTGACTGAAACGGTCGGGTAT Locus tag: Shal_1571 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Shal_1572 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Shal_1573 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Shal_1574 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Shal_1575 Name: hscB Funciton: Chaperone protein HscB Locus tag: Shal_1576 Name: hscA Funciton: Chaperone protein HscA Locus tag: Shal_1577 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Shal_1571	iscR	Iron-sulfur cluster regulator IscR
	Shal_1572	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Shal_1573	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Shal_1574	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Shal_1575	hscB	Chaperone protein HscB
	Shal_1576	hscA	Chaperone protein HscA
	Shal_1577	fdx	ferredoxin, 2Fe-2S type, ISC system
Position: -28 Score: 5.1 Sequence: ATAACCCAGTAACTTACTAAGGTAT Locus tag: Shal_3986 Name: ygbA Funciton: hypothetical protein involved in nitrosative stress
	Shal_3986	ygbA	hypothetical protein involved in nitrosative stress

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD