Regulon of IscR in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_1292
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.8 Sequence: ATACTTGAACAAAATAGTCAGGTAA Locus tag: Sama_0843 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Sama_0843	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -87 Score: 4.8 Sequence: TTAACCCAGCAAAATACTCAAGTTT Locus tag: Sama_3236 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Sama_3236	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -44 Score: 4.7 Sequence: AATTCTTAGTAATTTACTCAGGTTT Locus tag: Sama_3502 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Sama_3502	nfuA	NfuA Fe-S protein maturation
Position: -91 Score: 5.6 Sequence: ATACTTGAGTAAATTAGTTGGTTTT Position: -66 Score: 6.5 Sequence: ATAGTTGACTAAATTACTCAGGTAT Locus tag: Sama_1292 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Sama_1293 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Sama_1294 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Sama_1295 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Sama_1296 Name: hscB Funciton: Chaperone protein HscB Locus tag: Sama_1297 Name: hscA Funciton: Chaperone protein HscA Locus tag: Sama_1298 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Sama_1292	iscR	Iron-sulfur cluster regulator IscR
	Sama_1293	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Sama_1294	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Sama_1295	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Sama_1296	hscB	Chaperone protein HscB
	Sama_1297	hscA	Chaperone protein HscA
	Sama_1298	fdx	ferredoxin, 2Fe-2S type, ISC system
Position: -30 Score: 5.1 Sequence: AAAACCAAGTAAATTACTTGGGTAT Locus tag: Sama_3326 Name: ygbA Funciton: hypothetical protein involved in nitrosative stress
	Sama_3326	ygbA	hypothetical protein involved in nitrosative stress

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD