Regulon of IscR in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_1861
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.8 Sequence: ATACTTGAACAAAATAGTCAGGTAA Locus tag: Sputw3181_3041 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Sputw3181_3041	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -46 Score: 5 Sequence: AATTCTTACTAAAACACTCAGGTAT Locus tag: Sputw3181_0119 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Sputw3181_0119	nfuA	NfuA Fe-S protein maturation
Position: -90 Score: 5.6 Sequence: ATTCCTGAGTGTTTTAGTCGGGTTT Locus tag: Sputw3181_3715 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	Sputw3181_3715	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -29 Score: 4.9 Sequence: ATATCCGAGTAACTGACTAAGGTAT Locus tag: Sputw3181_3804 Name: ygbA Funciton: hypothetical protein involved in nitrosative stress
	Sputw3181_3804	ygbA	hypothetical protein involved in nitrosative stress
Position: -91 Score: 4.3 Sequence: TTACCTGAGTGTTTTAGTAGGACTT Position: -66 Score: 6.4 Sequence: ATACTTGACTAATTTACTCGGGTAT Locus tag: Sputw3181_1861 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Sputw3181_1862 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Sputw3181_1863 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Sputw3181_1864 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Sputw3181_1865 Name: hscB Funciton: Chaperone protein HscB Locus tag: Sputw3181_1866 Name: hscA Funciton: Chaperone protein HscA Locus tag: Sputw3181_1867 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Sputw3181_1861	iscR	Iron-sulfur cluster regulator IscR
	Sputw3181_1862	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Sputw3181_1863	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Sputw3181_1864	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Sputw3181_1865	hscB	Chaperone protein HscB
	Sputw3181_1866	hscA	Chaperone protein HscA
	Sputw3181_1867	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD