Regulon of IscR in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO_2263
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Shewanellaceae
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 93 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 5.5 Sequence: ATACTTGAGTGATTTACTAGGTTTT Position: -65 Score: 6.4 Sequence: ATACTTGACTGATTTACTCGGGTAT Locus tag: SO_2263 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: SO_2264 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: SO_2265 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: SO_2266 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: SO_2267 Name: hscB Funciton: Chaperone protein HscB Locus tag: SO_2268 Name: hscA Funciton: Chaperone protein HscA
	SO_2263	iscR	Iron-sulfur cluster regulator IscR
	SO_2264	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	SO_2265	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	SO_2266	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	SO_2267	hscB	Chaperone protein HscB
	SO_2268	hscA	Chaperone protein HscA
Position: -46 Score: 5 Sequence: AATTCTTACTAAAACACTCAGGTAT Locus tag: SO_4619 Name: nfuA Funciton: NfuA Fe-S protein maturation
	SO_4619	nfuA	NfuA Fe-S protein maturation
Position: -88 Score: 5.8 Sequence: ATACTTGAACAAAATAGTCAGGTAA Locus tag: SO_1304 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	SO_1304	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -167 Score: 5.1 Sequence: AATCTTGACTATTTTAGTCAAGATT Locus tag: SO_4302 Name: dnrN Funciton: Nitric oxide-dependent regulator DnrN or NorA
	SO_4302	dnrN	Nitric oxide-dependent regulator DnrN or NorA
Position: -29 Score: 4.1 Sequence: TTATCCGAGTCACAGACTAAGGTAT Locus tag: SO_0324 Name: ygbA Funciton: hypothetical protein involved in nitrosative stress
	SO_0324	ygbA	hypothetical protein involved in nitrosative stress

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD