Regulog CmbR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | repressor (activator) |
| Biological process: | Cysteine metabolism |
| Effector: | O-acetyl-L-serine |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LysR
- By effector - O-acetyl-L-serine
- By pathway - Cysteine metabolism
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | 14 | 5 |
| Lactococcus lactis subsp. lactis Il1403 | 21 | 9 |
| Streptococcus agalactiae 2603V/R | 8 | 4 |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 6 | 3 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | 7 | 4 |
| Streptococcus gallolyticus UCN34 | 21 | 9 |
| Streptococcus gordonii str. Challis substr. CH1 | 10 | 5 |
| Streptococcus mitis B6 | 10 | 6 |
| Streptococcus mutans UA159 | 14 | 6 |
| Streptococcus pneumoniae TIGR4 | 11 | 7 |
| Streptococcus pyogenes M1 GAS | 4 | 2 |
| Streptococcus sanguinis SK36 | 13 | 5 |
| Streptococcus suis 05ZYH33 | 6 | 4 |
| Streptococcus thermophilus CNRZ1066 | 20 | 10 |
| Streptococcus uberis 0140J | 5 | 4 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| metA |
|
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -132 score = 4.33984 sequence = GCCATAGGCAAGTTTTATTAT Gene: L0101: Homoserine O-succinyltransferase (EC 2.3.1.46) |
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -107 score = 4.29451 sequence = ATTATAGCTAAAAACTATAAC Gene: GALLO_0824: Homoserine O-succinyltransferase (EC 2.3.1.46) |
Gene: SGO_1002: Homoserine O-succinyltransferase (EC 2.3.1.46) |
Gene: smi_1566: Homoserine O-succinyltransferase (EC 2.3.1.46) |
Gene: SMU.1466: Homoserine O-succinyltransferase (EC 2.3.1.46) |
*
Streptococcus pneumoniae TIGR4 Site: position = -145 score = 4.64256 sequence = GATATAAAAATAGACTATAAC Gene: SP_1576: Homoserine O-succinyltransferase (EC 2.3.1.46) |
|
Gene: SSA_1420: Homoserine O-succinyltransferase (EC 2.3.1.46) |
*
Streptococcus suis 05ZYH33 Site: position = -46 score = 4.6566 sequence = GTTATAGCCAAAACTTATAAC Gene: SSU05_1306: Homoserine O-succinyltransferase (EC 2.3.1.46) |
Gene: str1222: Homoserine O-succinyltransferase (EC 2.3.1.46) |
|
Homoserine O-succinyltransferase (EC 2.3.1.46) |
| metB1 |
|
Gene: L0102: Cystathionine gamma-synthase (EC 2.5.1.48) |
|
|
|
|
|
|
|
|
|
|
|
|
|
Cystathionine gamma-synthase (EC 2.5.1.48) |
| CRON 2. | ||||||||||||||||
| cysD |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -171 score = 4.38338 sequence = ACTATTTAAAAATTCTATAAC Gene: LACR_0068: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -172 score = 4.1544 sequence = TCCATTAAAAAATCATATCGA Gene: L75975: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) |
|
|
|
|
|
|
|
|
|
|
|
|
|
O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) |
| CRON 3. | ||||||||||||||||
| dfpB |
Gene: LACR_0592: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -59 score = 4.81709 sequence = TTGAAAAAATATTTTTATTAG Gene: L167675: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Gene: SAG1063: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -10 score = 4.3809 sequence = ATGATAAAATATGGCTATGAA Gene: SDEG_1040: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -177 score = 4.68511 sequence = TTGATAGTATCATTATATCAC Site: position = -10 score = 4.3444 sequence = CTGATAAAATATGGCTATGAA Gene: Sez_0944: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Gene: GALLO_1120: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Gene: SGO_1212: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Gene: smi_1193: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Gene: SMU.1074: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Gene: SP_1230: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
*
Streptococcus pyogenes M1 GAS Site: position = -16 score = 4.72001 sequence = TTGATAAAATATGACTATGAA Gene: SPy1221: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Gene: SSA_1201: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Gene: SSU05_0689: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
*
Streptococcus thermophilus CNRZ1066 Site: position = -83 score = 4.3207 sequence = GTTATAACTTTATTTTATATG Gene: str0790: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Gene: SUB0943: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) |
| dfpA |
|
Gene: L166912: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: SAG1064: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: SDEG_1041: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: Sez_0943: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: GALLO_1121: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: SGO_1213: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: smi_1194: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: SMU.1075: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: SP_1231: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: SPy1222: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: SSA_1202: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: SSU05_0688: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: str0789: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Gene: SUB0944: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) |
| panT |
Gene: LACR_0590: Core component PanP of predicted pantothenate ECF transporter |
Gene: L166479: Core component PanP of predicted pantothenate ECF transporter |
Gene: SAG1065: Core component PanP of predicted pantothenate ECF transporter |
Gene: SDEG_1042: Core component PanP of predicted pantothenate ECF transporter |
Gene: Sez_0942: Core component PanP of predicted pantothenate ECF transporter |
Gene: GALLO_1122: Core component PanP of predicted pantothenate ECF transporter |
Gene: SGO_1214: Core component PanP of predicted pantothenate ECF transporter |
Gene: smi_1195: Core component PanP of predicted pantothenate ECF transporter |
Gene: SMU.1076: Core component PanP of predicted pantothenate ECF transporter |
Gene: SP_1232: Core component PanP of predicted pantothenate ECF transporter |
Gene: SPy1223: Core component PanP of predicted pantothenate ECF transporter |
Gene: SSA_1203: Core component PanP of predicted pantothenate ECF transporter |
Gene: SSU05_0687: Core component PanP of predicted pantothenate ECF transporter |
Gene: str0788: Core component PanP of predicted pantothenate ECF transporter |
Gene: SUB0945: Core component PanP of predicted pantothenate ECF transporter |
Core component PanP of predicted pantothenate ECF transporter |
| CRON 4. | ||||||||||||||||
| plp |
*4
Lactococcus lactis subsp. cremoris SK11 Site: position = -476 score = 4.35449 sequence = TTTATAAATTAAACTTAAAAA Gene: LACR_0360: Methionine ABC transporter, substrate-binding protein Gene: LACR_0361: Methionine ABC transporter, substrate-binding protein Gene: LACR_0362: Methionine ABC transporter, substrate-binding protein Gene: LACR_0364: Methionine ABC transporter, substrate-binding protein |
*4
Lactococcus lactis subsp. lactis Il1403 Site: position = -514 score = 4.35449 sequence = TTTATAAATTAAACTTAAAAA Gene: L117444: Methionine ABC transporter, substrate-binding protein Gene: L118475: Methionine ABC transporter, substrate-binding protein Gene: L119452: Methionine ABC transporter, substrate-binding protein Gene: L120334: Methionine ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Methionine ABC transporter, substrate-binding protein |
| LACR_0363 |
Gene: LACR_0363: Predicted reductase |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Predicted reductase |
| metP |
Gene: LACR_0365: Methionine ABC transporter, permease protein |
Gene: L121289: Methionine ABC transporter, permease protein |
Gene: SAG1639: Methionine ABC transporter, permease protein |
Gene: SDEG_0385: Methionine ABC transporter, permease protein |
Gene: Sez_1677: Methionine ABC transporter, permease protein |
Gene: GALLO_1842: Methionine ABC transporter, permease protein |
Gene: SGO_0460: Methionine ABC transporter, permease protein |
Gene: smi_1942: Methionine ABC transporter, permease protein |
Gene: SMU.1939c: Methionine ABC transporter, permease protein |
Gene: SP_0151: Methionine ABC transporter, permease protein |
Gene: SPy0320: Methionine ABC transporter, permease protein |
Gene: SSA_0376: Methionine ABC transporter, permease protein |
Gene: SSU05_1769: Methionine ABC transporter, permease protein |
Gene: str0301: Methionine ABC transporter, permease protein |
Gene: SUB0368: Methionine ABC transporter, permease protein |
Methionine ABC transporter, permease protein |
| metN |
Gene: LACR_0366: Methionine ABC transporter, ATP-binding protein |
Gene: L122401: Methionine ABC transporter, ATP-binding protein |
Gene: SAG1638: Methionine ABC transporter, ATP-binding protein |
Gene: SDEG_0386: Methionine ABC transporter, ATP-binding protein |
Gene: Sez_1676: Methionine ABC transporter, ATP-binding protein |
Gene: GALLO_1841: Methionine ABC transporter, ATP-binding protein |
Gene: SGO_0461: Methionine ABC transporter, ATP-binding protein |
Gene: smi_1941: Methionine ABC transporter, ATP-binding protein |
Gene: SMU.1938c: Methionine ABC transporter, ATP-binding protein |
Gene: SP_0152: Methionine ABC transporter, ATP-binding protein |
Gene: SPy0321: Methionine ABC transporter, ATP-binding protein |
Gene: SSA_0377: Methionine ABC transporter, ATP-binding protein |
Gene: SSU05_1768: Methionine ABC transporter, ATP-binding protein |
Gene: str0302: Methionine ABC transporter, ATP-binding protein |
Gene: SUB0369: Methionine ABC transporter, ATP-binding protein |
Methionine ABC transporter, ATP-binding protein |
| CRON 5. | ||||||||||||||||
| mmuP |
|
|
*
Streptococcus agalactiae 2603V/R Site: position = -97 score = 4.94653 sequence = GTAATAGTTTTTCTTTATCAT Gene: SAG1306: Predicted S-methylmethionine permease |
|
|
Gene: GALLO_1253: Predicted S-methylmethionine permease |
|
|
Gene: SMU.951: Predicted S-methylmethionine permease |
|
|
|
2
Streptococcus suis 05ZYH33 Gene: SSU05_2025: Predicted S-methylmethionine permease Gene: SSU05_2026: Predicted S-methylmethionine permease |
*
Streptococcus thermophilus CNRZ1066 Site: position = -22 score = 4.81521 sequence = GTGATAGTTTTTCTCTATCTC Gene: str0583: Predicted S-methylmethionine permease |
|
Predicted S-methylmethionine permease |
| mmuM |
|
|
Gene: SAG1305: Homocysteine S-methyltransferase (EC 2.1.1.10) |
|
|
Gene: GALLO_1252: Homocysteine S-methyltransferase (EC 2.1.1.10) |
|
|
Gene: SMU.952: Homocysteine S-methyltransferase (EC 2.1.1.10) |
|
|
Gene: SSA_1096: Homocysteine S-methyltransferase (EC 2.1.1.10) |
Gene: SSU05_2024: Homocysteine S-methyltransferase (EC 2.1.1.10) |
Gene: str0584: Homocysteine S-methyltransferase (EC 2.1.1.10) |
|
Homocysteine S-methyltransferase (EC 2.1.1.10) |
| CRON 6. | ||||||||||||||||
| yvdE |
|
|
Gene: SAG1643: Predicted glutamine amidotransferase, class I |
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -61 score = 5.01704 sequence = AGGATAGAATAATCTTATCAC Site: position = -98 score = 5.18707 sequence = GTGATAAAAAAAATCTATTGG Gene: GALLO_1848: Predicted glutamine amidotransferase, class I |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -97 score = 5.52483 sequence = TTGATAAAAAATTTTTATAAG Gene: SGO_0167: Predicted glutamine amidotransferase, class I |
|
|
*
Streptococcus pneumoniae TIGR4 Site: position = -64 score = 5.20372 sequence = TCCATAAAAAATGTTTATCAC Gene: SP_2072: Predicted glutamine amidotransferase, class I |
|
*
Streptococcus sanguinis SK36 Site: position = -100 score = 5.76257 sequence = CTGATAAAAAATTTTTATAAC Gene: SSA_2164: Predicted glutamine amidotransferase, class I |
*
Streptococcus suis 05ZYH33 Site: position = -95 score = 5.26709 sequence = CTGATAGTTATTTTTTATCAA Gene: SSU05_1773: Predicted glutamine amidotransferase, class I |
|
|
Predicted glutamine amidotransferase, class I |
| gshT |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -136 score = 4.4642 sequence = ATCATAAATCTTTTTTATGGT Gene: LACR_2344: Predicted glutathione ABC transporter, substrate-binding protein |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -136 score = 4.70194 sequence = GTCATAAATCTTTTTTATGGT Gene: L121253: Predicted glutathione ABC transporter, substrate-binding protein |
Gene: SAG1642: Predicted glutathione ABC transporter, substrate-binding protein |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -75 score = 4.98272 sequence = TTGATAGGAATTAATTATTAG Gene: SDEG_0381: Predicted glutathione ABC transporter, substrate-binding protein |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -41 score = 4.97954 sequence = ATGATAAACTAATCTTATGAA Gene: Sez_1680: Predicted glutathione ABC transporter, substrate-binding protein |
*2
Streptococcus gallolyticus UCN34 Gene: GALLO_1847: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -122 score = 5.9614 sequence = GTGATAAGTTTTATTTATCAC Gene: GALLO_1845: Predicted glutathione ABC transporter, substrate-binding protein |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -85 score = 4.72336 sequence = GCAATAAATAAAATTTATACC Gene: SGO_0457: Predicted glutathione ABC transporter, substrate-binding protein |
*3
Streptococcus mitis B6 Site: position = -101 score = 5.07671 sequence = ATGATTAAGTTTTTTTATCAC Gene: smi_1579: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -99 score = 5.12134 sequence = GCCATAAAGAAAACCTATCAC Gene: smi_1946: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -99 score = 5.12134 sequence = GCCATAAAGAAAACCTATCAC Gene: smi_1945: Predicted glutathione ABC transporter, substrate-binding protein |
*
Streptococcus mutans UA159 Site: position = -76 score = 4.57855 sequence = GTGATAGAAATTATATAATAG Site: position = -98 score = 5.95948 sequence = GTGATAGAATTTTCTTATCAC Gene: SMU.1942c: Predicted glutathione ABC transporter, substrate-binding protein |
*2
Streptococcus pneumoniae TIGR4 Site: position = -100 score = 4.9204 sequence = ATGATTAAGTTTTTCTATCAC Gene: SP_0620: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -99 score = 5.26901 sequence = CCCATAAAAAAAACTTATCAC Gene: SP_0148: Predicted glutathione ABC transporter, substrate-binding protein |
*
Streptococcus pyogenes M1 GAS Site: position = -75 score = 4.49716 sequence = TTGATAGGAATCAATTATTAG Gene: SPy0317: Predicted glutathione ABC transporter, substrate-binding protein |
*
Streptococcus sanguinis SK36 Site: position = -100 score = 4.8219 sequence = CTGATAAAGAAAAGCTATCAC Gene: SSA_0588: Predicted glutathione ABC transporter, substrate-binding protein |
|
*2
Streptococcus thermophilus CNRZ1066 Site: position = -98 score = 5.74466 sequence = GTGATAGTATTTTCTTATCAC Gene: str0296: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -101 score = 5.19132 sequence = TTGATAGATATTGTTTATCAG Gene: str0908: Predicted glutathione ABC transporter, substrate-binding protein |
*
Streptococcus uberis 0140J Site: position = -93 score = 4.86736 sequence = GTGATAGAGAACTATTATCAT Site: position = -71 score = 4.22533 sequence = GCGATAGTGAATCACTATTAG Gene: SUB0365: Predicted glutathione ABC transporter, substrate-binding protein |
Predicted glutathione ABC transporter, substrate-binding protein |
| CRON 7. | ||||||||||||||||
| tcyD |
|
|
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -104 score = 4.90252 sequence = GCTATAAGCAAATCTTATGGC Gene: GALLO_1275: Predicted uroporphyrinogen-III decarboxylase |
|
|
*
Streptococcus mutans UA159 Site: position = -168 score = 4.98933 sequence = GTGATAACTTTTTCTTATGGC Site: position = -103 score = 5.30886 sequence = GTCATAAATAAAATTTATAGC Gene: SMU.932: Predicted uroporphyrinogen-III decarboxylase |
|
|
*2
Streptococcus sanguinis SK36 Site: position = -194 score = 5.25904 sequence = TTGATAAAAATTACCTATCTC Site: position = -59 score = 5.0691 sequence = TTGATAAATATTTTTAATCAG Gene: SSA_2105: Predicted uroporphyrinogen-III decarboxylase Gene: SSA_2102: Predicted uroporphyrinogen-III decarboxylase |
|
|
|
Predicted uroporphyrinogen-III decarboxylase |
| SSA_2103 |
|
|
|
|
|
|
|
|
|
|
|
Gene: SSA_2103: Hypothetical protein |
|
|
|
Hypothetical protein |
| tcyE |
|
|
|
|
|
Gene: GALLO_1274: Predicted cysteine ABC transporter, substrate-binding protein |
|
|
Gene: SMU.933: Predicted cysteine ABC transporter, substrate-binding protein |
|
|
Gene: SSA_2101: Predicted cysteine ABC transporter, substrate-binding protein |
|
|
|
Predicted cysteine ABC transporter, substrate-binding protein |
| tcyF |
|
|
|
|
|
Gene: GALLO_1273: Predicted cysteine ABC transporter, permease protein 1 |
|
|
Gene: SMU.934: Predicted cysteine ABC transporter, permease protein 1 |
|
|
Gene: SSA_2099: Predicted cysteine ABC transporter, permease protein 1 |
|
|
|
Predicted cysteine ABC transporter, permease protein 1 |
| tcyG |
|
|
|
|
|
Gene: GALLO_1272: Predicted cysteine ABC transporter, permease protein 2 |
|
|
Gene: SMU.935: Predicted cysteine ABC transporter, permease protein 2 |
|
|
Gene: SSA_2098: Predicted cysteine ABC transporter, permease protein 2 |
|
|
|
Predicted cysteine ABC transporter, permease protein 2 |
| tcyH |
|
|
|
|
|
Gene: GALLO_1271: Predicted cysteine ABC transporter, ATP-binding protein |
|
|
Gene: SMU.936: Predicted cysteine ABC transporter, ATP-binding protein |
|
|
Gene: SSA_2097: Predicted cysteine ABC transporter, ATP-binding protein |
|
|
|
Predicted cysteine ABC transporter, ATP-binding protein |
| CRON 8. | ||||||||||||||||
| homR |
|
|
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -113 score = 5.9252 sequence = GTTATAAAAAAATCTTATCAC Site: position = -175 score = 4.36234 sequence = ATAATCTAAATTTTTTATTAT Gene: GALLO_1277: Homocysteine biosynthesis transcriptional regulato HomR, LysR family |
|
|
*
Streptococcus mutans UA159 Site: position = -110 score = 4.98933 sequence = GCCATAAGAAAAAGTTATCAC Site: position = -175 score = 5.30886 sequence = GCTATAAATTTTATTTATGAC Gene: SMU.930c: Homocysteine biosynthesis transcriptional regulato HomR, LysR family |
|
|
|
|
*
Streptococcus thermophilus CNRZ1066 Site: position = -108 score = 5.27337 sequence = TTTATAAAAATTTCATATCAG Gene: str0452: Homocysteine biosynthesis transcriptional regulato HomR, LysR family |
|
Homocysteine biosynthesis transcriptional regulato HomR, LysR family |
| CRON 9. | ||||||||||||||||
| str1582 |
|
|
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -96 score = 5.2609 sequence = GCTATAAAAATTATTTATGGC Gene: GALLO_1237: Predicted polar amino acid ABC transporter, permease protein 1 |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -139 score = 5.1766 sequence = CTTATAAATTTTTTCTATCAG Site: position = -117 score = 4.85418 sequence = CCGATAAAATATACATATTAT Gene: SGO_0985: Predicted polar amino acid ABC transporter, permease protein 1 |
*
Streptococcus mitis B6 Site: position = -80 score = 4.43512 sequence = GCAATAAAAAATAGATATTAT Site: position = -102 score = 5.50008 sequence = ATGATAAAAAATCCTTATAAC Gene: smi_1436: Predicted polar amino acid ABC transporter, permease protein 1 |
|
*
Streptococcus pneumoniae TIGR4 Site: position = -140 score = 4.43512 sequence = GCAATAAAAAATAGATATTAT Gene: SP_0711: Predicted polar amino acid ABC transporter, permease protein 1 |
|
|
|
*
Streptococcus thermophilus CNRZ1066 Site: position = -215 score = 5.17228 sequence = TTGATAAAAAATACATATTAT Site: position = -237 score = 4.84379 sequence = GTTATATCTTTTCTTTATCAC Gene: str1582: Predicted polar amino acid ABC transporter, permease protein 1 |
|
Predicted polar amino acid ABC transporter, permease protein 1 |
| str1581 |
|
|
|
|
|
Gene: GALLO_1236: Predicted polar amino acid ABC transporter, permease protein 2 |
Gene: SGO_0984: Predicted polar amino acid ABC transporter, permease protein 2 |
Gene: smi_1437: Predicted polar amino acid ABC transporter, permease protein 2 |
|
Gene: SP_0710: Predicted polar amino acid ABC transporter, permease protein 2 |
|
|
|
Gene: str1581: Predicted polar amino acid ABC transporter, permease protein 2 |
|
Predicted polar amino acid ABC transporter, permease protein 2 |
| str1580 |
|
|
|
|
|
Gene: GALLO_1235: Predicted polar amino acid ABC transporter, ATP-binding protein |
Gene: SGO_0983: Predicted polar amino acid ABC transporter, ATP-binding protein |
Gene: smi_1438: Predicted polar amino acid ABC transporter, ATP-binding protein |
|
Gene: SP_0709: Predicted polar amino acid ABC transporter, ATP-binding protein |
|
|
|
Gene: str1580: Predicted polar amino acid ABC transporter, ATP-binding protein |
|
Predicted polar amino acid ABC transporter, ATP-binding protein |
| str1579 |
|
|
|
|
|
Gene: GALLO_1234: Predicted polar amino acid ABC transporter, substrate-binding protein |
Gene: SGO_0982: Predicted polar amino acid ABC transporter, substrate-binding protein |
Gene: smi_1439: Predicted polar amino acid ABC transporter, substrate-binding protein |
|
|
|
|
|
Gene: str1579: Predicted polar amino acid ABC transporter, substrate-binding protein |
|
Predicted polar amino acid ABC transporter, substrate-binding protein |
| CRON 10. | ||||||||||||||||
| tcyA |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -77 score = 5.1493 sequence = GCTATAAGTTTTTTTTATGGC Gene: LACR_1009: Cystine ABC transporter, substrate-binding protein |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -77 score = 5.1493 sequence = GCTATAAGTTTTTTTTATGGC Gene: L162009: Cystine ABC transporter, substrate-binding protein |
*
Streptococcus agalactiae 2603V/R Site: position = -75 score = 4.7161 sequence = CTGATAAGGAAATACTATTAT Site: position = -96 score = 5.50597 sequence = TTGATATAAAATCTTTATCAC Gene: SAG0290: Cystine ABC transporter, substrate-binding protein |
Gene: SDEG_1720: Cystine ABC transporter, substrate-binding protein |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -98 score = 4.7192 sequence = TTGATACTATTTTCTTATTGC Site: position = -76 score = 4.2288 sequence = TTGATAGAGAAATGATATTAT Gene: Sez_1582: Cystine ABC transporter, substrate-binding protein |
*
Streptococcus gallolyticus UCN34 Site: position = -100 score = 5.15548 sequence = CTGATAGTTTTTTCTTATCAA Gene: GALLO_0414: Cystine ABC transporter, substrate-binding protein |
|
|
*
Streptococcus mutans UA159 Site: position = -102 score = 5.77804 sequence = GTGATAGAAAAATATTATCAC Site: position = -80 score = 5.02244 sequence = GTGATAGGAAAAAACTATTAT Gene: SMU.459: Cystine ABC transporter, substrate-binding protein |
|
|
|
|
Gene: str1654: Cystine ABC transporter, substrate-binding protein |
*
Streptococcus uberis 0140J Site: position = -76 score = 4.22281 sequence = TTGATAGAAAAATGGTATTAT Site: position = -98 score = 4.49505 sequence = GTCATATAAATAGCTAATTAC Gene: SUB1416: Cystine ABC transporter, substrate-binding protein |
Cystine ABC transporter, substrate-binding protein |
| tcyB |
Gene: LACR_1010: Cystine ABC transporter, permease protein |
Gene: L163056: Cystine ABC transporter, permease protein |
Gene: SAG0291: Cystine ABC transporter, permease protein |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -99 score = 5.26026 sequence = GTGATAAGTTTTGCTTATTGC Gene: SDEG_1719: Cystine ABC transporter, permease protein |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -106 score = 4.99102 sequence = GCGATAGGCTTTTCTTATCGT Gene: Sez_1580: Cystine ABC transporter, permease protein |
Gene: GALLO_0415: Cystine ABC transporter, permease protein |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -170 score = 4.71616 sequence = GTCATAAAATTTGCTTATACC Site: position = -148 score = 4.33024 sequence = TTGATAAATAATTTATACTGT Gene: SGO_0578: Cystine ABC transporter, permease protein |
*
Streptococcus mitis B6 Site: position = -164 score = 4.66282 sequence = GAGATAGTTTTTACTTATCTC Site: position = -142 score = 4.9887 sequence = TTGATAGATAAAATATATAGC Gene: smi_1382: Cystine ABC transporter, permease protein |
Gene: SMU.460: Cystine ABC transporter, permease protein |
*
Streptococcus pneumoniae TIGR4 Site: position = -164 score = 4.28892 sequence = GAAATAGTTTTTATCTATCTC Site: position = -142 score = 5.19207 sequence = TTGATAGATAAAATATATAAC Gene: SP_1461: Cystine ABC transporter, permease protein |
Gene: SPy1658: Cystine ABC transporter, permease protein |
*
Streptococcus sanguinis SK36 Site: position = -228 score = 5.2953 sequence = GTGATAAGAAAAATATATTAG Site: position = -250 score = 5.40375 sequence = GTGATATACTTTTCTTATCGC Gene: SSA_1868: Cystine ABC transporter, permease protein |
|
*
Streptococcus thermophilus CNRZ1066 Site: position = -217 score = 5.78713 sequence = GTGATATGATTTACTTATCAC Gene: str1653: Cystine ABC transporter, permease protein |
*
Streptococcus uberis 0140J Site: position = -80 score = 4.76621 sequence = GTGATAGGCTTTAACTATTGC Gene: SUB1415: Cystine ABC transporter, permease protein |
Cystine ABC transporter, permease protein |
| tcyC |
Gene: LACR_1011: Cystine ABC transporter, ATP-binding protein |
Gene: L164012: Cystine ABC transporter, ATP-binding protein |
Gene: SAG0292: Cystine ABC transporter, ATP-binding protein |
Gene: SDEG_1718: Cystine ABC transporter, ATP-binding protein |
Gene: Sez_1579: Cystine ABC transporter, ATP-binding protein |
Gene: GALLO_0416: Cystine ABC transporter, ATP-binding protein |
Gene: SGO_0579: Cystine ABC transporter, ATP-binding protein |
Gene: smi_1381: Cystine ABC transporter, ATP-binding protein |
Gene: SMU.461: Cystine ABC transporter, ATP-binding protein |
Gene: SP_1460: Cystine ABC transporter, ATP-binding protein |
Gene: SPy1657: Cystine ABC transporter, ATP-binding protein |
Gene: SSA_1867: Cystine ABC transporter, ATP-binding protein |
|
Gene: str1652: Cystine ABC transporter, ATP-binding protein |
Gene: SUB1414: Cystine ABC transporter, ATP-binding protein |
Cystine ABC transporter, ATP-binding protein |
| CRON 11. | ||||||||||||||||
| COG1739 |
Gene: LACR_1191: Conserved hypothetical protein |
Gene: L98095: Conserved hypothetical protein |
Gene: SAG0335: Conserved hypothetical protein |
Gene: SDEG_1684: Conserved hypothetical protein |
Gene: Sez_1548: Conserved hypothetical protein |
Gene: GALLO_0501: Conserved hypothetical protein |
Gene: SGO_0607: Conserved hypothetical protein |
Gene: smi_2059: Conserved hypothetical protein |
Gene: SMU.497c: Conserved hypothetical protein |
Gene: SP_2209: Conserved hypothetical protein |
Gene: SPy1617: Conserved hypothetical protein |
Gene: SSA_1837: Conserved hypothetical protein |
Gene: SSU05_0436: Conserved hypothetical protein |
*
Streptococcus thermophilus CNRZ1066 Site: position = -16 score = 5.17835 sequence = ATGATAAAATTTTTTTATGGA Gene: str0367: Conserved hypothetical protein |
Gene: SUB1378: Conserved hypothetical protein |
Conserved hypothetical protein |
| cysK |
2
Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0832: Cysteine synthase (EC 2.5.1.47) Gene: LACR_0537: Cysteine synthase (EC 2.5.1.47) |
*2
Lactococcus lactis subsp. lactis Il1403 Gene: L0089: Cysteine synthase (EC 2.5.1.47) Site: position = -87 score = 4.47627 sequence = ATCATAAATTTTTTTTAGAGC Gene: L0088: Cysteine synthase (EC 2.5.1.47) |
Gene: SAG0334: Cysteine synthase (EC 2.5.1.47) |
Gene: SDEG_1685: Cysteine synthase (EC 2.5.1.47) |
Gene: Sez_1549: Cysteine synthase (EC 2.5.1.47) |
Gene: GALLO_0500: Cysteine synthase (EC 2.5.1.47) |
Gene: SGO_0606: Cysteine synthase (EC 2.5.1.47) |
*
Streptococcus mitis B6 Site: position = -98 score = 5.30517 sequence = GATATAAAAAAATCCTATCAC Gene: smi_2060: Cysteine synthase (EC 2.5.1.47) |
Gene: SMU.496: Cysteine synthase (EC 2.5.1.47) |
Gene: SP_2210: Cysteine synthase (EC 2.5.1.47) |
Gene: SPy1618: Cysteine synthase (EC 2.5.1.47) |
Gene: SSA_1839: Cysteine synthase (EC 2.5.1.47) |
Gene: SSU05_0435: Cysteine synthase (EC 2.5.1.47) |
2
Streptococcus thermophilus CNRZ1066 Gene: str0366: Cysteine synthase (EC 2.5.1.47) Gene: str0846: Cysteine synthase (EC 2.5.1.47) |
*
Streptococcus uberis 0140J Site: position = -104 score = 5.05278 sequence = ATGATAAGCCTTTCCTATCAC Gene: SUB1379: Cysteine synthase (EC 2.5.1.47) |
Cysteine synthase (EC 2.5.1.47) |
| metB2 |
Gene: LACR_0831: Cystathionine gamma-lyase (EC 4.4.1.1) |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -79 score = 5.32787 sequence = GCTATAAAAAAATCTTATAGC Gene: L0181: Cystathionine gamma-lyase (EC 4.4.1.1) |
|
|
|
|
|
|
|
|
|
|
|
Gene: str0847: Cystathionine gamma-lyase (EC 4.4.1.1) |
|
Cystathionine gamma-lyase (EC 4.4.1.1) |
| CRON 12. | ||||||||||||||||
| metE |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -39 score = 4.69923 sequence = TTGATAAGATAGACCTATTAA Gene: LACR_1368: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -76 score = 4.13098 sequence = ATCATATTAAAAATGTATTAT Site: position = -39 score = 4.69923 sequence = TTGATAAGATAGACCTATTAA Gene: L0100: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus agalactiae 2603V/R Site: position = -109 score = 4.11009 sequence = GCTAAAAATATAAAATATTAA Gene: SAG2049: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -172 score = 4.63362 sequence = GTTATAGTTAAAAACTATAAT Site: position = -221 score = 4.23548 sequence = ATAATAAATTTTATTAATCTA Gene: GALLO_1316: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -182 score = 4.18778 sequence = GTTATAGTTTTTGATTATACC Gene: SGO_0310: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
Gene: smi_1600: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus mutans UA159 Site: position = -188 score = 4.60062 sequence = GTTATAGATGAAAACTATAAC Gene: SMU.873: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus pneumoniae TIGR4 Site: position = -218 score = 4.8589 sequence = CTTATAAGAATTACTAATAAC Gene: SP_0585: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
|
*
Streptococcus sanguinis SK36 Site: position = -182 score = 4.34545 sequence = GTCATAATTTCTACCTATAGC Gene: SSA_0416: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus suis 05ZYH33 Site: position = -237 score = 4.33539 sequence = TTCATAGATAAAATCTATACC Gene: SSU05_1774: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
*
Streptococcus thermophilus CNRZ1066 Site: position = -119 score = 4.17431 sequence = GCTATACAAATATCTAATTAA Gene: str0785: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
|
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
| metF |
Gene: LACR_1367: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
Gene: L0099: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
|
|
|
Gene: SGO_0311: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
Gene: smi_1599: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
Gene: SP_0586: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
Gene: SSA_0417: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
Gene: SSU05_1775: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
Gene: str0786: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
|
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
| metH |
|
|
Gene: SAG2048: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain |
|
|
Gene: GALLO_1315: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain |
|
|
Gene: SMU.874: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain |
|
|
|
|
|
|
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain |
| CRON 13. | ||||||||||||||||
| metB |
|
Gene: L0102: Cystathionine gamma-synthase (EC 2.5.1.48) |
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -142 score = 5.00573 sequence = GTTATAGTTTTTACTTATAGC Gene: GALLO_1768: Cystathionine gamma-synthase (EC 2.5.1.48) |
Gene: SGO_1636: Cystathionine gamma-synthase (EC 2.5.1.48) |
Gene: smi_1508: Cystathionine gamma-synthase (EC 2.5.1.48) |
*
Streptococcus mutans UA159 Site: position = -110 score = 4.28317 sequence = CTTATAGTTTCTTTTTATAGC Gene: SMU.1675: Cystathionine gamma-synthase (EC 2.5.1.48) |
Gene: SP_1525: Cystathionine gamma-synthase (EC 2.5.1.48) |
|
Gene: SSA_1737: Cystathionine gamma-synthase (EC 2.5.1.48) |
*
Streptococcus suis 05ZYH33 Site: position = -120 score = 5.05408 sequence = GTTATAAAGAAAAACTATAAC Gene: SSU05_1562: Cystathionine gamma-synthase (EC 2.5.1.48) |
*
Streptococcus thermophilus CNRZ1066 Site: position = -132 score = 4.48483 sequence = GTTATAGTAATAAACTATATC Gene: str0352: Cystathionine gamma-synthase (EC 2.5.1.48) |
|
Cystathionine gamma-synthase (EC 2.5.1.48) |
| metC |
Gene: LACR_2187: L-cysteine desulfhydrase |
Gene: L177593: L-cysteine desulfhydrase |
*
Streptococcus agalactiae 2603V/R Site: position = -152 score = 4.46656 sequence = ATGATAAATTAAAATAATAAA Gene: SAG1587: L-cysteine desulfhydrase |
|
|
Gene: GALLO_1767: L-cysteine desulfhydrase |
Gene: SGO_1635: L-cysteine desulfhydrase |
Gene: smi_1507: L-cysteine desulfhydrase |
Gene: SMU.1674: L-cysteine desulfhydrase |
Gene: SP_1524: L-cysteine desulfhydrase |
|
Gene: SSA_1736: L-cysteine desulfhydrase |
Gene: SSU05_1561: L-cysteine desulfhydrase |
Gene: str0353: L-cysteine desulfhydrase |
Gene: SUB0427: L-cysteine desulfhydrase |
L-cysteine desulfhydrase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |