Regulog CmbR - Streptococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Statistics of regulated genes
Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11	14	5
Lactococcus lactis subsp. lactis Il1403	21	9
Streptococcus agalactiae 2603V/R	8	4
Streptococcus dysgalactiae subsp. equisimilis GGS_124	6	3
Streptococcus equi subsp. zooepidemicus MGCS10565	7	4
Streptococcus gallolyticus UCN34	21	9
Streptococcus gordonii str. Challis substr. CH1	10	5
Streptococcus mitis B6	10	6
Streptococcus mutans UA159	14	6
Streptococcus pneumoniae TIGR4	11	7
Streptococcus pyogenes M1 GAS	4	2
Streptococcus sanguinis SK36	13	5
Streptococcus suis 05ZYH33	6	4
Streptococcus thermophilus CNRZ1066	20	10
Streptococcus uberis 0140J	5	4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
metA	Lactococcus lactis subsp. cremoris SK11	* Lactococcus lactis subsp. lactis Il1403 Site: position = -132 score = 4.33984 sequence = GCCATAGGCAAGTTTTATTAT Gene: L0101: Homoserine O-succinyltransferase (EC 2.3.1.46)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -107 score = 4.29451 sequence = ATTATAGCTAAAAACTATAAC Gene: GALLO_0824: Homoserine O-succinyltransferase (EC 2.3.1.46)	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1002: Homoserine O-succinyltransferase (EC 2.3.1.46)	Streptococcus mitis B6 Gene: smi_1566: Homoserine O-succinyltransferase (EC 2.3.1.46)	Streptococcus mutans UA159 Gene: SMU.1466: Homoserine O-succinyltransferase (EC 2.3.1.46)	* Streptococcus pneumoniae TIGR4 Site: position = -145 score = 4.64256 sequence = GATATAAAAATAGACTATAAC Gene: SP_1576: Homoserine O-succinyltransferase (EC 2.3.1.46)	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_1420: Homoserine O-succinyltransferase (EC 2.3.1.46)	* Streptococcus suis 05ZYH33 Site: position = -46 score = 4.6566 sequence = GTTATAGCCAAAACTTATAAC Gene: SSU05_1306: Homoserine O-succinyltransferase (EC 2.3.1.46)	Streptococcus thermophilus CNRZ1066 Gene: str1222: Homoserine O-succinyltransferase (EC 2.3.1.46)	Streptococcus uberis 0140J	Homoserine O-succinyltransferase (EC 2.3.1.46)
metB1	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403 Gene: L0102: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Cystathionine gamma-synthase (EC 2.5.1.48)

CRON 2.
cysD	* Lactococcus lactis subsp. cremoris SK11 Site: position = -171 score = 4.38338 sequence = ACTATTTAAAAATTCTATAAC Gene: LACR_0068: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49)	* Lactococcus lactis subsp. lactis Il1403 Site: position = -172 score = 4.1544 sequence = TCCATTAAAAAATCATATCGA Gene: L75975: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	O-acetylhomoserine sulfhydrylase (EC 2.5.1.49)

CRON 3.
dfpB	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0592: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	* Lactococcus lactis subsp. lactis Il1403 Site: position = -59 score = 4.81709 sequence = TTGAAAAAATATTTTTATTAG Gene: L167675: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Streptococcus agalactiae 2603V/R Gene: SAG1063: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -10 score = 4.3809 sequence = ATGATAAAATATGGCTATGAA Gene: SDEG_1040: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -177 score = 4.68511 sequence = TTGATAGTATCATTATATCAC Site: position = -10 score = 4.3444 sequence = CTGATAAAATATGGCTATGAA Gene: Sez_0944: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Streptococcus gallolyticus UCN34 Gene: GALLO_1120: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1212: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Streptococcus mitis B6 Gene: smi_1193: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Streptococcus mutans UA159 Gene: SMU.1074: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Streptococcus pneumoniae TIGR4 Gene: SP_1230: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	* Streptococcus pyogenes M1 GAS Site: position = -16 score = 4.72001 sequence = TTGATAAAATATGACTATGAA Gene: SPy1221: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Streptococcus sanguinis SK36 Gene: SSA_1201: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Streptococcus suis 05ZYH33 Gene: SSU05_0689: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	* Streptococcus thermophilus CNRZ1066 Site: position = -83 score = 4.3207 sequence = GTTATAACTTTATTTTATATG Gene: str0790: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Streptococcus uberis 0140J Gene: SUB0943: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)	Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
dfpA	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403 Gene: L166912: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus agalactiae 2603V/R Gene: SAG1064: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1041: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0943: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus gallolyticus UCN34 Gene: GALLO_1121: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1213: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus mitis B6 Gene: smi_1194: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus mutans UA159 Gene: SMU.1075: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus pneumoniae TIGR4 Gene: SP_1231: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus pyogenes M1 GAS Gene: SPy1222: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus sanguinis SK36 Gene: SSA_1202: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus suis 05ZYH33 Gene: SSU05_0688: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus thermophilus CNRZ1066 Gene: str0789: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Streptococcus uberis 0140J Gene: SUB0944: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)	Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
panT	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0590: Core component PanP of predicted pantothenate ECF transporter	Lactococcus lactis subsp. lactis Il1403 Gene: L166479: Core component PanP of predicted pantothenate ECF transporter	Streptococcus agalactiae 2603V/R Gene: SAG1065: Core component PanP of predicted pantothenate ECF transporter	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1042: Core component PanP of predicted pantothenate ECF transporter	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0942: Core component PanP of predicted pantothenate ECF transporter	Streptococcus gallolyticus UCN34 Gene: GALLO_1122: Core component PanP of predicted pantothenate ECF transporter	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1214: Core component PanP of predicted pantothenate ECF transporter	Streptococcus mitis B6 Gene: smi_1195: Core component PanP of predicted pantothenate ECF transporter	Streptococcus mutans UA159 Gene: SMU.1076: Core component PanP of predicted pantothenate ECF transporter	Streptococcus pneumoniae TIGR4 Gene: SP_1232: Core component PanP of predicted pantothenate ECF transporter	Streptococcus pyogenes M1 GAS Gene: SPy1223: Core component PanP of predicted pantothenate ECF transporter	Streptococcus sanguinis SK36 Gene: SSA_1203: Core component PanP of predicted pantothenate ECF transporter	Streptococcus suis 05ZYH33 Gene: SSU05_0687: Core component PanP of predicted pantothenate ECF transporter	Streptococcus thermophilus CNRZ1066 Gene: str0788: Core component PanP of predicted pantothenate ECF transporter	Streptococcus uberis 0140J Gene: SUB0945: Core component PanP of predicted pantothenate ECF transporter	Core component PanP of predicted pantothenate ECF transporter

CRON 4.
plp	4 Lactococcus lactis subsp. cremoris SK11* Site: position = -476 score = 4.35449 sequence = TTTATAAATTAAACTTAAAAA Gene: LACR_0360: Methionine ABC transporter, substrate-binding protein Gene: LACR_0361: Methionine ABC transporter, substrate-binding protein Gene: LACR_0362: Methionine ABC transporter, substrate-binding protein Gene: LACR_0364: Methionine ABC transporter, substrate-binding protein	4 Lactococcus lactis subsp. lactis Il1403* Site: position = -514 score = 4.35449 sequence = TTTATAAATTAAACTTAAAAA Gene: L117444: Methionine ABC transporter, substrate-binding protein Gene: L118475: Methionine ABC transporter, substrate-binding protein Gene: L119452: Methionine ABC transporter, substrate-binding protein Gene: L120334: Methionine ABC transporter, substrate-binding protein	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Methionine ABC transporter, substrate-binding protein
LACR_0363	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0363: Predicted reductase	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted reductase
metP	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0365: Methionine ABC transporter, permease protein	Lactococcus lactis subsp. lactis Il1403 Gene: L121289: Methionine ABC transporter, permease protein	Streptococcus agalactiae 2603V/R Gene: SAG1639: Methionine ABC transporter, permease protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_0385: Methionine ABC transporter, permease protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1677: Methionine ABC transporter, permease protein	Streptococcus gallolyticus UCN34 Gene: GALLO_1842: Methionine ABC transporter, permease protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0460: Methionine ABC transporter, permease protein	Streptococcus mitis B6 Gene: smi_1942: Methionine ABC transporter, permease protein	Streptococcus mutans UA159 Gene: SMU.1939c: Methionine ABC transporter, permease protein	Streptococcus pneumoniae TIGR4 Gene: SP_0151: Methionine ABC transporter, permease protein	Streptococcus pyogenes M1 GAS Gene: SPy0320: Methionine ABC transporter, permease protein	Streptococcus sanguinis SK36 Gene: SSA_0376: Methionine ABC transporter, permease protein	Streptococcus suis 05ZYH33 Gene: SSU05_1769: Methionine ABC transporter, permease protein	Streptococcus thermophilus CNRZ1066 Gene: str0301: Methionine ABC transporter, permease protein	Streptococcus uberis 0140J Gene: SUB0368: Methionine ABC transporter, permease protein	Methionine ABC transporter, permease protein
metN	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0366: Methionine ABC transporter, ATP-binding protein	Lactococcus lactis subsp. lactis Il1403 Gene: L122401: Methionine ABC transporter, ATP-binding protein	Streptococcus agalactiae 2603V/R Gene: SAG1638: Methionine ABC transporter, ATP-binding protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_0386: Methionine ABC transporter, ATP-binding protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1676: Methionine ABC transporter, ATP-binding protein	Streptococcus gallolyticus UCN34 Gene: GALLO_1841: Methionine ABC transporter, ATP-binding protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0461: Methionine ABC transporter, ATP-binding protein	Streptococcus mitis B6 Gene: smi_1941: Methionine ABC transporter, ATP-binding protein	Streptococcus mutans UA159 Gene: SMU.1938c: Methionine ABC transporter, ATP-binding protein	Streptococcus pneumoniae TIGR4 Gene: SP_0152: Methionine ABC transporter, ATP-binding protein	Streptococcus pyogenes M1 GAS Gene: SPy0321: Methionine ABC transporter, ATP-binding protein	Streptococcus sanguinis SK36 Gene: SSA_0377: Methionine ABC transporter, ATP-binding protein	Streptococcus suis 05ZYH33 Gene: SSU05_1768: Methionine ABC transporter, ATP-binding protein	Streptococcus thermophilus CNRZ1066 Gene: str0302: Methionine ABC transporter, ATP-binding protein	Streptococcus uberis 0140J Gene: SUB0369: Methionine ABC transporter, ATP-binding protein	Methionine ABC transporter, ATP-binding protein

CRON 5.
mmuP	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	* Streptococcus agalactiae 2603V/R Site: position = -97 score = 4.94653 sequence = GTAATAGTTTTTCTTTATCAT Gene: SAG1306: Predicted S-methylmethionine permease	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1253: Predicted S-methylmethionine permease	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.951: Predicted S-methylmethionine permease	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	2 Streptococcus suis 05ZYH33 Gene: SSU05_2025: Predicted S-methylmethionine permease Gene: SSU05_2026: Predicted S-methylmethionine permease	* Streptococcus thermophilus CNRZ1066 Site: position = -22 score = 4.81521 sequence = GTGATAGTTTTTCTCTATCTC Gene: str0583: Predicted S-methylmethionine permease	Streptococcus uberis 0140J	Predicted S-methylmethionine permease
mmuM	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R Gene: SAG1305: Homocysteine S-methyltransferase (EC 2.1.1.10)	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1252: Homocysteine S-methyltransferase (EC 2.1.1.10)	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.952: Homocysteine S-methyltransferase (EC 2.1.1.10)	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_1096: Homocysteine S-methyltransferase (EC 2.1.1.10)	Streptococcus suis 05ZYH33 Gene: SSU05_2024: Homocysteine S-methyltransferase (EC 2.1.1.10)	Streptococcus thermophilus CNRZ1066 Gene: str0584: Homocysteine S-methyltransferase (EC 2.1.1.10)	Streptococcus uberis 0140J	Homocysteine S-methyltransferase (EC 2.1.1.10)

CRON 6.
yvdE	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R Gene: SAG1643: Predicted glutamine amidotransferase, class I	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -61 score = 5.01704 sequence = AGGATAGAATAATCTTATCAC Site: position = -98 score = 5.18707 sequence = GTGATAAAAAAAATCTATTGG Gene: GALLO_1848: Predicted glutamine amidotransferase, class I	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -97 score = 5.52483 sequence = TTGATAAAAAATTTTTATAAG Gene: SGO_0167: Predicted glutamine amidotransferase, class I	Streptococcus mitis B6	Streptococcus mutans UA159	* Streptococcus pneumoniae TIGR4 Site: position = -64 score = 5.20372 sequence = TCCATAAAAAATGTTTATCAC Gene: SP_2072: Predicted glutamine amidotransferase, class I	Streptococcus pyogenes M1 GAS	* Streptococcus sanguinis SK36 Site: position = -100 score = 5.76257 sequence = CTGATAAAAAATTTTTATAAC Gene: SSA_2164: Predicted glutamine amidotransferase, class I	* Streptococcus suis 05ZYH33 Site: position = -95 score = 5.26709 sequence = CTGATAGTTATTTTTTATCAA Gene: SSU05_1773: Predicted glutamine amidotransferase, class I	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted glutamine amidotransferase, class I
gshT	* Lactococcus lactis subsp. cremoris SK11 Site: position = -136 score = 4.4642 sequence = ATCATAAATCTTTTTTATGGT Gene: LACR_2344: Predicted glutathione ABC transporter, substrate-binding protein	* Lactococcus lactis subsp. lactis Il1403 Site: position = -136 score = 4.70194 sequence = GTCATAAATCTTTTTTATGGT Gene: L121253: Predicted glutathione ABC transporter, substrate-binding protein	Streptococcus agalactiae 2603V/R Gene: SAG1642: Predicted glutathione ABC transporter, substrate-binding protein	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -75 score = 4.98272 sequence = TTGATAGGAATTAATTATTAG Gene: SDEG_0381: Predicted glutathione ABC transporter, substrate-binding protein	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -41 score = 4.97954 sequence = ATGATAAACTAATCTTATGAA Gene: Sez_1680: Predicted glutathione ABC transporter, substrate-binding protein	2 Streptococcus gallolyticus UCN34* Gene: GALLO_1847: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -122 score = 5.9614 sequence = GTGATAAGTTTTATTTATCAC Gene: GALLO_1845: Predicted glutathione ABC transporter, substrate-binding protein	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -85 score = 4.72336 sequence = GCAATAAATAAAATTTATACC Gene: SGO_0457: Predicted glutathione ABC transporter, substrate-binding protein	3 Streptococcus mitis B6* Site: position = -101 score = 5.07671 sequence = ATGATTAAGTTTTTTTATCAC Gene: smi_1579: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -99 score = 5.12134 sequence = GCCATAAAGAAAACCTATCAC Gene: smi_1946: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -99 score = 5.12134 sequence = GCCATAAAGAAAACCTATCAC Gene: smi_1945: Predicted glutathione ABC transporter, substrate-binding protein	* Streptococcus mutans UA159 Site: position = -76 score = 4.57855 sequence = GTGATAGAAATTATATAATAG Site: position = -98 score = 5.95948 sequence = GTGATAGAATTTTCTTATCAC Gene: SMU.1942c: Predicted glutathione ABC transporter, substrate-binding protein	2 Streptococcus pneumoniae TIGR4* Site: position = -100 score = 4.9204 sequence = ATGATTAAGTTTTTCTATCAC Gene: SP_0620: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -99 score = 5.26901 sequence = CCCATAAAAAAAACTTATCAC Gene: SP_0148: Predicted glutathione ABC transporter, substrate-binding protein	* Streptococcus pyogenes M1 GAS Site: position = -75 score = 4.49716 sequence = TTGATAGGAATCAATTATTAG Gene: SPy0317: Predicted glutathione ABC transporter, substrate-binding protein	* Streptococcus sanguinis SK36 Site: position = -100 score = 4.8219 sequence = CTGATAAAGAAAAGCTATCAC Gene: SSA_0588: Predicted glutathione ABC transporter, substrate-binding protein	Streptococcus suis 05ZYH33	2 Streptococcus thermophilus CNRZ1066* Site: position = -98 score = 5.74466 sequence = GTGATAGTATTTTCTTATCAC Gene: str0296: Predicted glutathione ABC transporter, substrate-binding protein Site: position = -101 score = 5.19132 sequence = TTGATAGATATTGTTTATCAG Gene: str0908: Predicted glutathione ABC transporter, substrate-binding protein	* Streptococcus uberis 0140J Site: position = -93 score = 4.86736 sequence = GTGATAGAGAACTATTATCAT Site: position = -71 score = 4.22533 sequence = GCGATAGTGAATCACTATTAG Gene: SUB0365: Predicted glutathione ABC transporter, substrate-binding protein	Predicted glutathione ABC transporter, substrate-binding protein

CRON 7.
tcyD	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -104 score = 4.90252 sequence = GCTATAAGCAAATCTTATGGC Gene: GALLO_1275: Predicted uroporphyrinogen-III decarboxylase	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	* Streptococcus mutans UA159 Site: position = -168 score = 4.98933 sequence = GTGATAACTTTTTCTTATGGC Site: position = -103 score = 5.30886 sequence = GTCATAAATAAAATTTATAGC Gene: SMU.932: Predicted uroporphyrinogen-III decarboxylase	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	2 Streptococcus sanguinis SK36* Site: position = -194 score = 5.25904 sequence = TTGATAAAAATTACCTATCTC Site: position = -59 score = 5.0691 sequence = TTGATAAATATTTTTAATCAG Gene: SSA_2105: Predicted uroporphyrinogen-III decarboxylase Gene: SSA_2102: Predicted uroporphyrinogen-III decarboxylase	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted uroporphyrinogen-III decarboxylase
SSA_2103	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_2103: Hypothetical protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Hypothetical protein
tcyE	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1274: Predicted cysteine ABC transporter, substrate-binding protein	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.933: Predicted cysteine ABC transporter, substrate-binding protein	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_2101: Predicted cysteine ABC transporter, substrate-binding protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted cysteine ABC transporter, substrate-binding protein
tcyF	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1273: Predicted cysteine ABC transporter, permease protein 1	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.934: Predicted cysteine ABC transporter, permease protein 1	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_2099: Predicted cysteine ABC transporter, permease protein 1	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted cysteine ABC transporter, permease protein 1
tcyG	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1272: Predicted cysteine ABC transporter, permease protein 2	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.935: Predicted cysteine ABC transporter, permease protein 2	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_2098: Predicted cysteine ABC transporter, permease protein 2	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted cysteine ABC transporter, permease protein 2
tcyH	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1271: Predicted cysteine ABC transporter, ATP-binding protein	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.936: Predicted cysteine ABC transporter, ATP-binding protein	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_2097: Predicted cysteine ABC transporter, ATP-binding protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted cysteine ABC transporter, ATP-binding protein

CRON 8.
homR	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -113 score = 5.9252 sequence = GTTATAAAAAAATCTTATCAC Site: position = -175 score = 4.36234 sequence = ATAATCTAAATTTTTTATTAT Gene: GALLO_1277: Homocysteine biosynthesis transcriptional regulato HomR, LysR family	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	* Streptococcus mutans UA159 Site: position = -110 score = 4.98933 sequence = GCCATAAGAAAAAGTTATCAC Site: position = -175 score = 5.30886 sequence = GCTATAAATTTTATTTATGAC Gene: SMU.930c: Homocysteine biosynthesis transcriptional regulato HomR, LysR family	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	* Streptococcus thermophilus CNRZ1066 Site: position = -108 score = 5.27337 sequence = TTTATAAAAATTTCATATCAG Gene: str0452: Homocysteine biosynthesis transcriptional regulato HomR, LysR family	Streptococcus uberis 0140J	Homocysteine biosynthesis transcriptional regulato HomR, LysR family

CRON 9.
str1582	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -96 score = 5.2609 sequence = GCTATAAAAATTATTTATGGC Gene: GALLO_1237: Predicted polar amino acid ABC transporter, permease protein 1	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -139 score = 5.1766 sequence = CTTATAAATTTTTTCTATCAG Site: position = -117 score = 4.85418 sequence = CCGATAAAATATACATATTAT Gene: SGO_0985: Predicted polar amino acid ABC transporter, permease protein 1	* Streptococcus mitis B6 Site: position = -80 score = 4.43512 sequence = GCAATAAAAAATAGATATTAT Site: position = -102 score = 5.50008 sequence = ATGATAAAAAATCCTTATAAC Gene: smi_1436: Predicted polar amino acid ABC transporter, permease protein 1	Streptococcus mutans UA159	* Streptococcus pneumoniae TIGR4 Site: position = -140 score = 4.43512 sequence = GCAATAAAAAATAGATATTAT Gene: SP_0711: Predicted polar amino acid ABC transporter, permease protein 1	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	* Streptococcus thermophilus CNRZ1066 Site: position = -215 score = 5.17228 sequence = TTGATAAAAAATACATATTAT Site: position = -237 score = 4.84379 sequence = GTTATATCTTTTCTTTATCAC Gene: str1582: Predicted polar amino acid ABC transporter, permease protein 1	Streptococcus uberis 0140J	Predicted polar amino acid ABC transporter, permease protein 1
str1581	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1236: Predicted polar amino acid ABC transporter, permease protein 2	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0984: Predicted polar amino acid ABC transporter, permease protein 2	Streptococcus mitis B6 Gene: smi_1437: Predicted polar amino acid ABC transporter, permease protein 2	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4 Gene: SP_0710: Predicted polar amino acid ABC transporter, permease protein 2	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str1581: Predicted polar amino acid ABC transporter, permease protein 2	Streptococcus uberis 0140J	Predicted polar amino acid ABC transporter, permease protein 2
str1580	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1235: Predicted polar amino acid ABC transporter, ATP-binding protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0983: Predicted polar amino acid ABC transporter, ATP-binding protein	Streptococcus mitis B6 Gene: smi_1438: Predicted polar amino acid ABC transporter, ATP-binding protein	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4 Gene: SP_0709: Predicted polar amino acid ABC transporter, ATP-binding protein	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str1580: Predicted polar amino acid ABC transporter, ATP-binding protein	Streptococcus uberis 0140J	Predicted polar amino acid ABC transporter, ATP-binding protein
str1579	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1234: Predicted polar amino acid ABC transporter, substrate-binding protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0982: Predicted polar amino acid ABC transporter, substrate-binding protein	Streptococcus mitis B6 Gene: smi_1439: Predicted polar amino acid ABC transporter, substrate-binding protein	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str1579: Predicted polar amino acid ABC transporter, substrate-binding protein	Streptococcus uberis 0140J	Predicted polar amino acid ABC transporter, substrate-binding protein

CRON 10.
tcyA	* Lactococcus lactis subsp. cremoris SK11 Site: position = -77 score = 5.1493 sequence = GCTATAAGTTTTTTTTATGGC Gene: LACR_1009: Cystine ABC transporter, substrate-binding protein	* Lactococcus lactis subsp. lactis Il1403 Site: position = -77 score = 5.1493 sequence = GCTATAAGTTTTTTTTATGGC Gene: L162009: Cystine ABC transporter, substrate-binding protein	* Streptococcus agalactiae 2603V/R Site: position = -75 score = 4.7161 sequence = CTGATAAGGAAATACTATTAT Site: position = -96 score = 5.50597 sequence = TTGATATAAAATCTTTATCAC Gene: SAG0290: Cystine ABC transporter, substrate-binding protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1720: Cystine ABC transporter, substrate-binding protein	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -98 score = 4.7192 sequence = TTGATACTATTTTCTTATTGC Site: position = -76 score = 4.2288 sequence = TTGATAGAGAAATGATATTAT Gene: Sez_1582: Cystine ABC transporter, substrate-binding protein	* Streptococcus gallolyticus UCN34 Site: position = -100 score = 5.15548 sequence = CTGATAGTTTTTTCTTATCAA Gene: GALLO_0414: Cystine ABC transporter, substrate-binding protein	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	* Streptococcus mutans UA159 Site: position = -102 score = 5.77804 sequence = GTGATAGAAAAATATTATCAC Site: position = -80 score = 5.02244 sequence = GTGATAGGAAAAAACTATTAT Gene: SMU.459: Cystine ABC transporter, substrate-binding protein	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str1654: Cystine ABC transporter, substrate-binding protein	* Streptococcus uberis 0140J Site: position = -76 score = 4.22281 sequence = TTGATAGAAAAATGGTATTAT Site: position = -98 score = 4.49505 sequence = GTCATATAAATAGCTAATTAC Gene: SUB1416: Cystine ABC transporter, substrate-binding protein	Cystine ABC transporter, substrate-binding protein
tcyB	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1010: Cystine ABC transporter, permease protein	Lactococcus lactis subsp. lactis Il1403 Gene: L163056: Cystine ABC transporter, permease protein	Streptococcus agalactiae 2603V/R Gene: SAG0291: Cystine ABC transporter, permease protein	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -99 score = 5.26026 sequence = GTGATAAGTTTTGCTTATTGC Gene: SDEG_1719: Cystine ABC transporter, permease protein	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -106 score = 4.99102 sequence = GCGATAGGCTTTTCTTATCGT Gene: Sez_1580: Cystine ABC transporter, permease protein	Streptococcus gallolyticus UCN34 Gene: GALLO_0415: Cystine ABC transporter, permease protein	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -170 score = 4.71616 sequence = GTCATAAAATTTGCTTATACC Site: position = -148 score = 4.33024 sequence = TTGATAAATAATTTATACTGT Gene: SGO_0578: Cystine ABC transporter, permease protein	* Streptococcus mitis B6 Site: position = -164 score = 4.66282 sequence = GAGATAGTTTTTACTTATCTC Site: position = -142 score = 4.9887 sequence = TTGATAGATAAAATATATAGC Gene: smi_1382: Cystine ABC transporter, permease protein	Streptococcus mutans UA159 Gene: SMU.460: Cystine ABC transporter, permease protein	* Streptococcus pneumoniae TIGR4 Site: position = -164 score = 4.28892 sequence = GAAATAGTTTTTATCTATCTC Site: position = -142 score = 5.19207 sequence = TTGATAGATAAAATATATAAC Gene: SP_1461: Cystine ABC transporter, permease protein	Streptococcus pyogenes M1 GAS Gene: SPy1658: Cystine ABC transporter, permease protein	* Streptococcus sanguinis SK36 Site: position = -228 score = 5.2953 sequence = GTGATAAGAAAAATATATTAG Site: position = -250 score = 5.40375 sequence = GTGATATACTTTTCTTATCGC Gene: SSA_1868: Cystine ABC transporter, permease protein	Streptococcus suis 05ZYH33	* Streptococcus thermophilus CNRZ1066 Site: position = -217 score = 5.78713 sequence = GTGATATGATTTACTTATCAC Gene: str1653: Cystine ABC transporter, permease protein	* Streptococcus uberis 0140J Site: position = -80 score = 4.76621 sequence = GTGATAGGCTTTAACTATTGC Gene: SUB1415: Cystine ABC transporter, permease protein	Cystine ABC transporter, permease protein
tcyC	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1011: Cystine ABC transporter, ATP-binding protein	Lactococcus lactis subsp. lactis Il1403 Gene: L164012: Cystine ABC transporter, ATP-binding protein	Streptococcus agalactiae 2603V/R Gene: SAG0292: Cystine ABC transporter, ATP-binding protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1718: Cystine ABC transporter, ATP-binding protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1579: Cystine ABC transporter, ATP-binding protein	Streptococcus gallolyticus UCN34 Gene: GALLO_0416: Cystine ABC transporter, ATP-binding protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0579: Cystine ABC transporter, ATP-binding protein	Streptococcus mitis B6 Gene: smi_1381: Cystine ABC transporter, ATP-binding protein	Streptococcus mutans UA159 Gene: SMU.461: Cystine ABC transporter, ATP-binding protein	Streptococcus pneumoniae TIGR4 Gene: SP_1460: Cystine ABC transporter, ATP-binding protein	Streptococcus pyogenes M1 GAS Gene: SPy1657: Cystine ABC transporter, ATP-binding protein	Streptococcus sanguinis SK36 Gene: SSA_1867: Cystine ABC transporter, ATP-binding protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str1652: Cystine ABC transporter, ATP-binding protein	Streptococcus uberis 0140J Gene: SUB1414: Cystine ABC transporter, ATP-binding protein	Cystine ABC transporter, ATP-binding protein

CRON 11.
COG1739	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1191: Conserved hypothetical protein	Lactococcus lactis subsp. lactis Il1403 Gene: L98095: Conserved hypothetical protein	Streptococcus agalactiae 2603V/R Gene: SAG0335: Conserved hypothetical protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1684: Conserved hypothetical protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1548: Conserved hypothetical protein	Streptococcus gallolyticus UCN34 Gene: GALLO_0501: Conserved hypothetical protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0607: Conserved hypothetical protein	Streptococcus mitis B6 Gene: smi_2059: Conserved hypothetical protein	Streptococcus mutans UA159 Gene: SMU.497c: Conserved hypothetical protein	Streptococcus pneumoniae TIGR4 Gene: SP_2209: Conserved hypothetical protein	Streptococcus pyogenes M1 GAS Gene: SPy1617: Conserved hypothetical protein	Streptococcus sanguinis SK36 Gene: SSA_1837: Conserved hypothetical protein	Streptococcus suis 05ZYH33 Gene: SSU05_0436: Conserved hypothetical protein	* Streptococcus thermophilus CNRZ1066 Site: position = -16 score = 5.17835 sequence = ATGATAAAATTTTTTTATGGA Gene: str0367: Conserved hypothetical protein	Streptococcus uberis 0140J Gene: SUB1378: Conserved hypothetical protein	Conserved hypothetical protein
cysK	2 Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0832: Cysteine synthase (EC 2.5.1.47) Gene: LACR_0537: Cysteine synthase (EC 2.5.1.47)	2 Lactococcus lactis subsp. lactis Il1403* Gene: L0089: Cysteine synthase (EC 2.5.1.47) Site: position = -87 score = 4.47627 sequence = ATCATAAATTTTTTTTAGAGC Gene: L0088: Cysteine synthase (EC 2.5.1.47)	Streptococcus agalactiae 2603V/R Gene: SAG0334: Cysteine synthase (EC 2.5.1.47)	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1685: Cysteine synthase (EC 2.5.1.47)	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1549: Cysteine synthase (EC 2.5.1.47)	Streptococcus gallolyticus UCN34 Gene: GALLO_0500: Cysteine synthase (EC 2.5.1.47)	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0606: Cysteine synthase (EC 2.5.1.47)	* Streptococcus mitis B6 Site: position = -98 score = 5.30517 sequence = GATATAAAAAAATCCTATCAC Gene: smi_2060: Cysteine synthase (EC 2.5.1.47)	Streptococcus mutans UA159 Gene: SMU.496: Cysteine synthase (EC 2.5.1.47)	Streptococcus pneumoniae TIGR4 Gene: SP_2210: Cysteine synthase (EC 2.5.1.47)	Streptococcus pyogenes M1 GAS Gene: SPy1618: Cysteine synthase (EC 2.5.1.47)	Streptococcus sanguinis SK36 Gene: SSA_1839: Cysteine synthase (EC 2.5.1.47)	Streptococcus suis 05ZYH33 Gene: SSU05_0435: Cysteine synthase (EC 2.5.1.47)	2 Streptococcus thermophilus CNRZ1066 Gene: str0366: Cysteine synthase (EC 2.5.1.47) Gene: str0846: Cysteine synthase (EC 2.5.1.47)	* Streptococcus uberis 0140J Site: position = -104 score = 5.05278 sequence = ATGATAAGCCTTTCCTATCAC Gene: SUB1379: Cysteine synthase (EC 2.5.1.47)	Cysteine synthase (EC 2.5.1.47)
metB2	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0831: Cystathionine gamma-lyase (EC 4.4.1.1)	* Lactococcus lactis subsp. lactis Il1403 Site: position = -79 score = 5.32787 sequence = GCTATAAAAAAATCTTATAGC Gene: L0181: Cystathionine gamma-lyase (EC 4.4.1.1)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str0847: Cystathionine gamma-lyase (EC 4.4.1.1)	Streptococcus uberis 0140J	Cystathionine gamma-lyase (EC 4.4.1.1)

CRON 12.
metE	* Lactococcus lactis subsp. cremoris SK11 Site: position = -39 score = 4.69923 sequence = TTGATAAGATAGACCTATTAA Gene: LACR_1368: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Lactococcus lactis subsp. lactis Il1403 Site: position = -76 score = 4.13098 sequence = ATCATATTAAAAATGTATTAT Site: position = -39 score = 4.69923 sequence = TTGATAAGATAGACCTATTAA Gene: L0100: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus agalactiae 2603V/R Site: position = -109 score = 4.11009 sequence = GCTAAAAATATAAAATATTAA Gene: SAG2049: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -172 score = 4.63362 sequence = GTTATAGTTAAAAACTATAAT Site: position = -221 score = 4.23548 sequence = ATAATAAATTTTATTAATCTA Gene: GALLO_1316: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -182 score = 4.18778 sequence = GTTATAGTTTTTGATTATACC Gene: SGO_0310: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	Streptococcus mitis B6 Gene: smi_1600: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus mutans UA159 Site: position = -188 score = 4.60062 sequence = GTTATAGATGAAAACTATAAC Gene: SMU.873: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus pneumoniae TIGR4 Site: position = -218 score = 4.8589 sequence = CTTATAAGAATTACTAATAAC Gene: SP_0585: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	Streptococcus pyogenes M1 GAS	* Streptococcus sanguinis SK36 Site: position = -182 score = 4.34545 sequence = GTCATAATTTCTACCTATAGC Gene: SSA_0416: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus suis 05ZYH33 Site: position = -237 score = 4.33539 sequence = TTCATAGATAAAATCTATACC Gene: SSU05_1774: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	* Streptococcus thermophilus CNRZ1066 Site: position = -119 score = 4.17431 sequence = GCTATACAAATATCTAATTAA Gene: str0785: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)	Streptococcus uberis 0140J	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metF	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1367: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Lactococcus lactis subsp. lactis Il1403 Gene: L0099: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0311: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus mitis B6 Gene: smi_1599: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4 Gene: SP_0586: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_0417: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus suis 05ZYH33 Gene: SSU05_1775: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus thermophilus CNRZ1066 Gene: str0786: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)	Streptococcus uberis 0140J	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metH	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R Gene: SAG2048: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1315: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.874: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain

CRON 13.
metB	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403 Gene: L0102: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -142 score = 5.00573 sequence = GTTATAGTTTTTACTTATAGC Gene: GALLO_1768: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1636: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus mitis B6 Gene: smi_1508: Cystathionine gamma-synthase (EC 2.5.1.48)	* Streptococcus mutans UA159 Site: position = -110 score = 4.28317 sequence = CTTATAGTTTCTTTTTATAGC Gene: SMU.1675: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus pneumoniae TIGR4 Gene: SP_1525: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_1737: Cystathionine gamma-synthase (EC 2.5.1.48)	* Streptococcus suis 05ZYH33 Site: position = -120 score = 5.05408 sequence = GTTATAAAGAAAAACTATAAC Gene: SSU05_1562: Cystathionine gamma-synthase (EC 2.5.1.48)	* Streptococcus thermophilus CNRZ1066 Site: position = -132 score = 4.48483 sequence = GTTATAGTAATAAACTATATC Gene: str0352: Cystathionine gamma-synthase (EC 2.5.1.48)	Streptococcus uberis 0140J	Cystathionine gamma-synthase (EC 2.5.1.48)
metC	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_2187: L-cysteine desulfhydrase	Lactococcus lactis subsp. lactis Il1403 Gene: L177593: L-cysteine desulfhydrase	* Streptococcus agalactiae 2603V/R Site: position = -152 score = 4.46656 sequence = ATGATAAATTAAAATAATAAA Gene: SAG1587: L-cysteine desulfhydrase	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1767: L-cysteine desulfhydrase	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1635: L-cysteine desulfhydrase	Streptococcus mitis B6 Gene: smi_1507: L-cysteine desulfhydrase	Streptococcus mutans UA159 Gene: SMU.1674: L-cysteine desulfhydrase	Streptococcus pneumoniae TIGR4 Gene: SP_1524: L-cysteine desulfhydrase	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_1736: L-cysteine desulfhydrase	Streptococcus suis 05ZYH33 Gene: SSU05_1561: L-cysteine desulfhydrase	Streptococcus thermophilus CNRZ1066 Gene: str0353: L-cysteine desulfhydrase	Streptococcus uberis 0140J Gene: SUB0427: L-cysteine desulfhydrase	L-cysteine desulfhydrase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CmbR - Streptococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --