Regulon of CmbR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type:	Transcription factor
TF locus tag:	LACR_0375
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	14
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -171 Score: 4.4 Sequence: ACTATTTAAAAATTCTATAAC Locus tag: LACR_0068 Name: cysD Funciton: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49)
	LACR_0068	cysD	O-acetylhomoserine sulfhydrylase (EC 2.5.1.49)
Position: -476 Score: 4.4 Sequence: TTTATAAATTAAACTTAAAAA Locus tag: LACR_0360 Name: plpA Funciton: Methionine ABC transporter, substrate-binding protein Locus tag: LACR_0361 Name: plpB Funciton: Methionine ABC transporter, substrate-binding protein Locus tag: LACR_0362 Name: plpC Funciton: Methionine ABC transporter, substrate-binding protein Locus tag: LACR_0363 Name: LACR_0363 Funciton: Predicted reductase Locus tag: LACR_0364 Name: plpD Funciton: Methionine ABC transporter, substrate-binding protein Locus tag: LACR_0365 Name: metP Funciton: Methionine ABC transporter, permease protein Locus tag: LACR_0366 Name: metN Funciton: Methionine ABC transporter, ATP-binding protein
	LACR_0360	plpA	Methionine ABC transporter, substrate-binding protein
	LACR_0361	plpB	Methionine ABC transporter, substrate-binding protein
	LACR_0362	plpC	Methionine ABC transporter, substrate-binding protein
	LACR_0363	LACR_0363	Predicted reductase
	LACR_0364	plpD	Methionine ABC transporter, substrate-binding protein
	LACR_0365	metP	Methionine ABC transporter, permease protein
	LACR_0366	metN	Methionine ABC transporter, ATP-binding protein
Position: -77 Score: 5.1 Sequence: GCTATAAGTTTTTTTTATGGC Locus tag: LACR_1009 Name: tcyA Funciton: Cystine ABC transporter, substrate-binding protein Locus tag: LACR_1010 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: LACR_1011 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	LACR_1009	tcyA	Cystine ABC transporter, substrate-binding protein
	LACR_1010	tcyB	Cystine ABC transporter, permease protein
	LACR_1011	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -39 Score: 4.7 Sequence: TTGATAAGATAGACCTATTAA Locus tag: LACR_1368 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) Locus tag: LACR_1367 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	LACR_1368	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	LACR_1367	metF	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Position: -136 Score: 4.5 Sequence: ATCATAAATCTTTTTTATGGT Locus tag: LACR_2344 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	LACR_2344	gshT	Predicted glutathione ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD