Regulon of CmbR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type:	Transcription factor
TF locus tag:	Sez_1132
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 4.7 Sequence: TTGATAGTATCATTATATCAC Position: -10 Score: 4.3 Sequence: CTGATAAAATATGGCTATGAA Locus tag: Sez_0944 Name: dfpB Funciton: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) Locus tag: Sez_0943 Name: dfpA Funciton: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) Locus tag: Sez_0942 Name: panT Funciton: Core component PanP of predicted pantothenate ECF transporter
	Sez_0944	dfpB	Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
	Sez_0943	dfpA	Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
	Sez_0942	panT	Core component PanP of predicted pantothenate ECF transporter
Position: -106 Score: 5 Sequence: GCGATAGGCTTTTCTTATCGT Locus tag: Sez_1580 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: Sez_1579 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	Sez_1580	tcyB	Cystine ABC transporter, permease protein
	Sez_1579	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -98 Score: 4.7 Sequence: TTGATACTATTTTCTTATTGC Position: -76 Score: 4.2 Sequence: TTGATAGAGAAATGATATTAT Locus tag: Sez_1582 Name: tcyA Funciton: Cystine ABC transporter, substrate-binding protein
	Sez_1582	tcyA	Cystine ABC transporter, substrate-binding protein
Position: -41 Score: 5 Sequence: ATGATAAACTAATCTTATGAA Locus tag: Sez_1680 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	Sez_1680	gshT	Predicted glutathione ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD