Regulon of CmbR in Streptococcus sanguinis SK36

Properties
Regulator type:	Transcription factor
TF locus tag:	SSA_1068
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	13
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -250 Score: 5.4 Sequence: GTGATATACTTTTCTTATCGC Position: -228 Score: 5.3 Sequence: GTGATAAGAAAAATATATTAG Locus tag: SSA_1868 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: SSA_1867 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	SSA_1868	tcyB	Cystine ABC transporter, permease protein
	SSA_1867	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -100 Score: 4.8 Sequence: CTGATAAAGAAAAGCTATCAC Locus tag: SSA_0588 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	SSA_0588	gshT	Predicted glutathione ABC transporter, substrate-binding protein
Position: -194 Score: 5.3 Sequence: TTGATAAAAATTACCTATCTC Position: -59 Score: 5.1 Sequence: TTGATAAATATTTTTAATCAG Locus tag: SSA_2105 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: SSA_2103 Name: SSA_2103 Funciton: Hypothetical protein Locus tag: SSA_2102 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: SSA_2101 Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein Locus tag: SSA_2099 Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1 Locus tag: SSA_2098 Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2 Locus tag: SSA_2097 Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein
	SSA_2105	tcyD	Predicted uroporphyrinogen-III decarboxylase
	SSA_2103	SSA_2103	Hypothetical protein
	SSA_2102	tcyD	Predicted uroporphyrinogen-III decarboxylase
	SSA_2101	tcyE	Predicted cysteine ABC transporter, substrate-binding protein
	SSA_2099	tcyF	Predicted cysteine ABC transporter, permease protein 1
	SSA_2098	tcyG	Predicted cysteine ABC transporter, permease protein 2
	SSA_2097	tcyH	Predicted cysteine ABC transporter, ATP-binding protein
Position: -182 Score: 4.3 Sequence: GTCATAATTTCTACCTATAGC Locus tag: SSA_0416 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) Locus tag: SSA_0417 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	SSA_0416	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	SSA_0417	metF	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Position: -100 Score: 5.8 Sequence: CTGATAAAAAATTTTTATAAC Locus tag: SSA_2164 Name: yvdE Funciton: Predicted glutamine amidotransferase, class I
	SSA_2164	yvdE	Predicted glutamine amidotransferase, class I

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD