Regulon of CmbR in Streptococcus thermophilus CNRZ1066

Properties
Regulator type:	Transcription factor
TF locus tag:	str0520
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	20
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 4.3 Sequence: GTTATAACTTTATTTTATATG Locus tag: str0790 Name: dfpB Funciton: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) Locus tag: str0789 Name: dfpA Funciton: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) Locus tag: str0788 Name: panT Funciton: Core component PanP of predicted pantothenate ECF transporter
	str0790	dfpB	Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
	str0789	dfpA	Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
	str0788	panT	Core component PanP of predicted pantothenate ECF transporter
Position: -101 Score: 5.2 Sequence: TTGATAGATATTGTTTATCAG Locus tag: str0908 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	str0908	gshT	Predicted glutathione ABC transporter, substrate-binding protein
Position: -108 Score: 5.3 Sequence: TTTATAAAAATTTCATATCAG Locus tag: str0452 Name: homR Funciton: Homocysteine biosynthesis transcriptional regulato HomR, LysR family
	str0452	homR	Homocysteine biosynthesis transcriptional regulato HomR, LysR family
Position: -22 Score: 4.8 Sequence: GTGATAGTTTTTCTCTATCTC Locus tag: str0583 Name: mmuP Funciton: Predicted S-methylmethionine permease Locus tag: str0584 Name: mmuM Funciton: Homocysteine S-methyltransferase (EC 2.1.1.10)
	str0583	mmuP	Predicted S-methylmethionine permease
	str0584	mmuM	Homocysteine S-methyltransferase (EC 2.1.1.10)
Position: -237 Score: 4.8 Sequence: GTTATATCTTTTCTTTATCAC Position: -215 Score: 5.2 Sequence: TTGATAAAAAATACATATTAT Locus tag: str1582 Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1 Locus tag: str1581 Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2 Locus tag: str1580 Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein Locus tag: str1579 Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein
	str1582	str1582	Predicted polar amino acid ABC transporter, permease protein 1
	str1581	str1581	Predicted polar amino acid ABC transporter, permease protein 2
	str1580	str1580	Predicted polar amino acid ABC transporter, ATP-binding protein
	str1579	str1579	Predicted polar amino acid ABC transporter, substrate-binding protein
Position: -16 Score: 5.2 Sequence: ATGATAAAATTTTTTTATGGA Locus tag: str0367 Name: COG1739 Funciton: Conserved hypothetical protein Locus tag: str0366 Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47)
	str0367	COG1739	Conserved hypothetical protein
	str0366	cysK	Cysteine synthase (EC 2.5.1.47)
Position: -217 Score: 5.8 Sequence: GTGATATGATTTACTTATCAC Locus tag: str1653 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: str1652 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	str1653	tcyB	Cystine ABC transporter, permease protein
	str1652	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -132 Score: 4.5 Sequence: GTTATAGTAATAAACTATATC Locus tag: str0352 Name: metB Funciton: Cystathionine gamma-synthase (EC 2.5.1.48) Locus tag: str0353 Name: metC Funciton: L-cysteine desulfhydrase
	str0352	metB	Cystathionine gamma-synthase (EC 2.5.1.48)
	str0353	metC	L-cysteine desulfhydrase
Position: -119 Score: 4.2 Sequence: GCTATACAAATATCTAATTAA Locus tag: str0785 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) Locus tag: str0786 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	str0785	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	str0786	metF	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Position: -98 Score: 5.7 Sequence: GTGATAGTATTTTCTTATCAC Locus tag: str0296 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	str0296	gshT	Predicted glutathione ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CmbR in Streptococcus thermophilus CNRZ1066

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --