Regulon of CmbR in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_0927
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	11
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -140 Score: 4.4 Sequence: GCAATAAAAAATAGATATTAT Locus tag: SP_0711 Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1 Locus tag: SP_0710 Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2 Locus tag: SP_0709 Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein
	SP_0711	str1582	Predicted polar amino acid ABC transporter, permease protein 1
	SP_0710	str1581	Predicted polar amino acid ABC transporter, permease protein 2
	SP_0709	str1580	Predicted polar amino acid ABC transporter, ATP-binding protein
Position: -218 Score: 4.9 Sequence: CTTATAAGAATTACTAATAAC Locus tag: SP_0585 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) Locus tag: SP_0586 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	SP_0585	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	SP_0586	metF	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Position: -100 Score: 4.9 Sequence: ATGATTAAGTTTTTCTATCAC Locus tag: SP_0620 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	SP_0620	gshT	Predicted glutathione ABC transporter, substrate-binding protein
Position: -164 Score: 4.3 Sequence: GAAATAGTTTTTATCTATCTC Position: -142 Score: 5.2 Sequence: TTGATAGATAAAATATATAAC Locus tag: SP_1461 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: SP_1460 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	SP_1461	tcyB	Cystine ABC transporter, permease protein
	SP_1460	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -99 Score: 5.3 Sequence: CCCATAAAAAAAACTTATCAC Locus tag: SP_0148 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	SP_0148	gshT	Predicted glutathione ABC transporter, substrate-binding protein
Position: -64 Score: 5.2 Sequence: TCCATAAAAAATGTTTATCAC Locus tag: SP_2072 Name: yvdE Funciton: Predicted glutamine amidotransferase, class I
	SP_2072	yvdE	Predicted glutamine amidotransferase, class I
Position: -145 Score: 4.6 Sequence: GATATAAAAATAGACTATAAC Locus tag: SP_1576 Name: metA Funciton: Homoserine O-succinyltransferase (EC 2.3.1.46)
	SP_1576	metA	Homoserine O-succinyltransferase (EC 2.3.1.46)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD