Regulon of CmbR in Streptococcus gordonii str. Challis substr. CH1

Properties
Regulator type:	Transcription factor
TF locus tag:	SGO_1088
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -170 Score: 4.7 Sequence: GTCATAAAATTTGCTTATACC Position: -148 Score: 4.3 Sequence: TTGATAAATAATTTATACTGT Locus tag: SGO_0578 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: SGO_0579 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	SGO_0578	tcyB	Cystine ABC transporter, permease protein
	SGO_0579	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -139 Score: 5.2 Sequence: CTTATAAATTTTTTCTATCAG Position: -117 Score: 4.9 Sequence: CCGATAAAATATACATATTAT Locus tag: SGO_0985 Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1 Locus tag: SGO_0984 Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2 Locus tag: SGO_0983 Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein Locus tag: SGO_0982 Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein
	SGO_0985	str1582	Predicted polar amino acid ABC transporter, permease protein 1
	SGO_0984	str1581	Predicted polar amino acid ABC transporter, permease protein 2
	SGO_0983	str1580	Predicted polar amino acid ABC transporter, ATP-binding protein
	SGO_0982	str1579	Predicted polar amino acid ABC transporter, substrate-binding protein
Position: -182 Score: 4.2 Sequence: GTTATAGTTTTTGATTATACC Locus tag: SGO_0310 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) Locus tag: SGO_0311 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	SGO_0310	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	SGO_0311	metF	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Position: -97 Score: 5.5 Sequence: TTGATAAAAAATTTTTATAAG Locus tag: SGO_0167 Name: yvdE Funciton: Predicted glutamine amidotransferase, class I
	SGO_0167	yvdE	Predicted glutamine amidotransferase, class I
Position: -85 Score: 4.7 Sequence: GCAATAAATAAAATTTATACC Locus tag: SGO_0457 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	SGO_0457	gshT	Predicted glutathione ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD