Regulon of CmbR in Streptococcus mitis B6

Properties
Regulator type:	Transcription factor
TF locus tag:	smi_0930
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -98 Score: 5.3 Sequence: GATATAAAAAAATCCTATCAC Locus tag: smi_2060 Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47)
	smi_2060	cysK	Cysteine synthase (EC 2.5.1.47)
Position: -102 Score: 5.5 Sequence: ATGATAAAAAATCCTTATAAC Position: -80 Score: 4.4 Sequence: GCAATAAAAAATAGATATTAT Locus tag: smi_1436 Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1 Locus tag: smi_1437 Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2 Locus tag: smi_1438 Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein Locus tag: smi_1439 Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein
	smi_1436	str1582	Predicted polar amino acid ABC transporter, permease protein 1
	smi_1437	str1581	Predicted polar amino acid ABC transporter, permease protein 2
	smi_1438	str1580	Predicted polar amino acid ABC transporter, ATP-binding protein
	smi_1439	str1579	Predicted polar amino acid ABC transporter, substrate-binding protein
Position: -164 Score: 4.7 Sequence: GAGATAGTTTTTACTTATCTC Position: -142 Score: 5 Sequence: TTGATAGATAAAATATATAGC Locus tag: smi_1382 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: smi_1381 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	smi_1382	tcyB	Cystine ABC transporter, permease protein
	smi_1381	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -101 Score: 5.1 Sequence: ATGATTAAGTTTTTTTATCAC Locus tag: smi_1579 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	smi_1579	gshT	Predicted glutathione ABC transporter, substrate-binding protein
Position: -99 Score: 5.1 Sequence: GCCATAAAGAAAACCTATCAC Locus tag: smi_1946 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	smi_1946	gshT	Predicted glutathione ABC transporter, substrate-binding protein
Position: -99 Score: 5.1 Sequence: GCCATAAAGAAAACCTATCAC Locus tag: smi_1945 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	smi_1945	gshT	Predicted glutathione ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD