Regulon of CmbR in Streptococcus pyogenes M1 GAS

Properties
Regulator type:	Transcription factor
TF locus tag:	SPy0824
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -16 Score: 4.7 Sequence: TTGATAAAATATGACTATGAA Locus tag: SPy1221 Name: dfpB Funciton: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) Locus tag: SPy1222 Name: dfpA Funciton: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) Locus tag: SPy1223 Name: panT Funciton: Core component PanP of predicted pantothenate ECF transporter
	SPy1221	dfpB	Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
	SPy1222	dfpA	Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
	SPy1223	panT	Core component PanP of predicted pantothenate ECF transporter
Position: -75 Score: 4.5 Sequence: TTGATAGGAATCAATTATTAG Locus tag: SPy0317 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	SPy0317	gshT	Predicted glutathione ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD