Regulon of CmbR in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_1340
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	21
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -175 Score: 4.4 Sequence: ATAATCTAAATTTTTTATTAT Position: -113 Score: 5.9 Sequence: GTTATAAAAAAATCTTATCAC Locus tag: GALLO_1277 Name: homR Funciton: Homocysteine biosynthesis transcriptional regulato HomR, LysR family
	GALLO_1277	homR	Homocysteine biosynthesis transcriptional regulato HomR, LysR family
Position: -104 Score: 4.9 Sequence: GCTATAAGCAAATCTTATGGC Locus tag: GALLO_1275 Name: tcyD Funciton: Predicted uroporphyrinogen-III decarboxylase Locus tag: GALLO_1274 Name: tcyE Funciton: Predicted cysteine ABC transporter, substrate-binding protein Locus tag: GALLO_1273 Name: tcyF Funciton: Predicted cysteine ABC transporter, permease protein 1 Locus tag: GALLO_1272 Name: tcyG Funciton: Predicted cysteine ABC transporter, permease protein 2 Locus tag: GALLO_1271 Name: tcyH Funciton: Predicted cysteine ABC transporter, ATP-binding protein
	GALLO_1275	tcyD	Predicted uroporphyrinogen-III decarboxylase
	GALLO_1274	tcyE	Predicted cysteine ABC transporter, substrate-binding protein
	GALLO_1273	tcyF	Predicted cysteine ABC transporter, permease protein 1
	GALLO_1272	tcyG	Predicted cysteine ABC transporter, permease protein 2
	GALLO_1271	tcyH	Predicted cysteine ABC transporter, ATP-binding protein
Position: -96 Score: 5.3 Sequence: GCTATAAAAATTATTTATGGC Locus tag: GALLO_1237 Name: str1582 Funciton: Predicted polar amino acid ABC transporter, permease protein 1 Locus tag: GALLO_1236 Name: str1581 Funciton: Predicted polar amino acid ABC transporter, permease protein 2 Locus tag: GALLO_1235 Name: str1580 Funciton: Predicted polar amino acid ABC transporter, ATP-binding protein Locus tag: GALLO_1234 Name: str1579 Funciton: Predicted polar amino acid ABC transporter, substrate-binding protein
	GALLO_1237	str1582	Predicted polar amino acid ABC transporter, permease protein 1
	GALLO_1236	str1581	Predicted polar amino acid ABC transporter, permease protein 2
	GALLO_1235	str1580	Predicted polar amino acid ABC transporter, ATP-binding protein
	GALLO_1234	str1579	Predicted polar amino acid ABC transporter, substrate-binding protein
Position: -221 Score: 4.2 Sequence: ATAATAAATTTTATTAATCTA Position: -172 Score: 4.6 Sequence: GTTATAGTTAAAAACTATAAT Locus tag: GALLO_1316 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) Locus tag: GALLO_1315 Name: metH Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain
	GALLO_1316	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	GALLO_1315	metH	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain
Position: -142 Score: 5 Sequence: GTTATAGTTTTTACTTATAGC Locus tag: GALLO_1768 Name: metB Funciton: Cystathionine gamma-synthase (EC 2.5.1.48) Locus tag: GALLO_1767 Name: metC Funciton: L-cysteine desulfhydrase
	GALLO_1768	metB	Cystathionine gamma-synthase (EC 2.5.1.48)
	GALLO_1767	metC	L-cysteine desulfhydrase
Position: -100 Score: 5.2 Sequence: CTGATAGTTTTTTCTTATCAA Locus tag: GALLO_0414 Name: tcyA Funciton: Cystine ABC transporter, substrate-binding protein Locus tag: GALLO_0415 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: GALLO_0416 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	GALLO_0414	tcyA	Cystine ABC transporter, substrate-binding protein
	GALLO_0415	tcyB	Cystine ABC transporter, permease protein
	GALLO_0416	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -98 Score: 5.2 Sequence: GTGATAAAAAAAATCTATTGG Position: -61 Score: 5 Sequence: AGGATAGAATAATCTTATCAC Locus tag: GALLO_1848 Name: yvdE Funciton: Predicted glutamine amidotransferase, class I Locus tag: GALLO_1847 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	GALLO_1848	yvdE	Predicted glutamine amidotransferase, class I
	GALLO_1847	gshT	Predicted glutathione ABC transporter, substrate-binding protein
Position: -122 Score: 6 Sequence: GTGATAAGTTTTATTTATCAC Locus tag: GALLO_1845 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	GALLO_1845	gshT	Predicted glutathione ABC transporter, substrate-binding protein
Position: -107 Score: 4.3 Sequence: ATTATAGCTAAAAACTATAAC Locus tag: GALLO_0824 Name: metA Funciton: Homoserine O-succinyltransferase (EC 2.3.1.46)
	GALLO_0824	metA	Homoserine O-succinyltransferase (EC 2.3.1.46)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CmbR in Streptococcus gallolyticus UCN34

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --