Regulon of CmbR in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type:	Transcription factor
TF locus tag:	SDEG_1187
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -10 Score: 4.4 Sequence: ATGATAAAATATGGCTATGAA Locus tag: SDEG_1040 Name: dfpB Funciton: Phosphopantothenoylcysteine synthetase (EC 6.3.2.5) Locus tag: SDEG_1041 Name: dfpA Funciton: Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) Locus tag: SDEG_1042 Name: panT Funciton: Core component PanP of predicted pantothenate ECF transporter
	SDEG_1040	dfpB	Phosphopantothenoylcysteine synthetase (EC 6.3.2.5)
	SDEG_1041	dfpA	Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36)
	SDEG_1042	panT	Core component PanP of predicted pantothenate ECF transporter
Position: -99 Score: 5.3 Sequence: GTGATAAGTTTTGCTTATTGC Locus tag: SDEG_1719 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: SDEG_1718 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	SDEG_1719	tcyB	Cystine ABC transporter, permease protein
	SDEG_1718	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -75 Score: 5 Sequence: TTGATAGGAATTAATTATTAG Locus tag: SDEG_0381 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	SDEG_0381	gshT	Predicted glutathione ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD