Regulon of CmbR in Streptococcus uberis 0140J

Properties
Regulator type:	Transcription factor
TF locus tag:	SUB0728
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 5.1 Sequence: ATGATAAGCCTTTCCTATCAC Locus tag: SUB1379 Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47)
	SUB1379	cysK	Cysteine synthase (EC 2.5.1.47)
Position: -80 Score: 4.8 Sequence: GTGATAGGCTTTAACTATTGC Locus tag: SUB1415 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: SUB1414 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	SUB1415	tcyB	Cystine ABC transporter, permease protein
	SUB1414	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -98 Score: 4.5 Sequence: GTCATATAAATAGCTAATTAC Position: -76 Score: 4.2 Sequence: TTGATAGAAAAATGGTATTAT Locus tag: SUB1416 Name: tcyA Funciton: Cystine ABC transporter, substrate-binding protein
	SUB1416	tcyA	Cystine ABC transporter, substrate-binding protein
Position: -93 Score: 4.9 Sequence: GTGATAGAGAACTATTATCAT Position: -71 Score: 4.2 Sequence: GCGATAGTGAATCACTATTAG Locus tag: SUB0365 Name: gshT Funciton: Predicted glutathione ABC transporter, substrate-binding protein
	SUB0365	gshT	Predicted glutathione ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD