Regulon of CmbR in Streptococcus agalactiae 2603V/R

Properties
Regulator type:	Transcription factor
TF locus tag:	SAG1176
Regulator family:	LysR
Regulation mode:	repressor (activator)
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine
Regulog:	CmbR - Streptococcaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 104 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LysR
By effector - O-acetyl-L-serine
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 4.9 Sequence: GTAATAGTTTTTCTTTATCAT Locus tag: SAG1306 Name: mmuP Funciton: Predicted S-methylmethionine permease Locus tag: SAG1305 Name: mmuM Funciton: Homocysteine S-methyltransferase (EC 2.1.1.10)
	SAG1306	mmuP	Predicted S-methylmethionine permease
	SAG1305	mmuM	Homocysteine S-methyltransferase (EC 2.1.1.10)
Position: -96 Score: 5.5 Sequence: TTGATATAAAATCTTTATCAC Position: -75 Score: 4.7 Sequence: CTGATAAGGAAATACTATTAT Locus tag: SAG0290 Name: tcyA Funciton: Cystine ABC transporter, substrate-binding protein Locus tag: SAG0291 Name: tcyB Funciton: Cystine ABC transporter, permease protein Locus tag: SAG0292 Name: tcyC Funciton: Cystine ABC transporter, ATP-binding protein
	SAG0290	tcyA	Cystine ABC transporter, substrate-binding protein
	SAG0291	tcyB	Cystine ABC transporter, permease protein
	SAG0292	tcyC	Cystine ABC transporter, ATP-binding protein
Position: -152 Score: 4.5 Sequence: ATGATAAATTAAAATAATAAA Locus tag: SAG1587 Name: metC Funciton: L-cysteine desulfhydrase
	SAG1587	metC	L-cysteine desulfhydrase
Position: -109 Score: 4.1 Sequence: GCTAAAAATATAAAATATTAA Locus tag: SAG2049 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) Locus tag: SAG2048 Name: metH Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain
	SAG2049	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	SAG2048	metH	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) / Homolog of homocysteine-binding domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD