Regulog Fur - Vibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 447 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Vibrio cholerae O1 biovar eltor str. N16961	63	32
Vibrio vulnificus CMCP6	77	37
Vibrio harveyi ATCC BAA-1116	94	45
Vibrio parahaemolyticus RIMD 2210633	91	40
Vibrio shilonii AK1	67	37
Vibrio splendidus LGP32	90	42
Vibrio fischeri ES114	70	24
Vibrio salmonicida LFI1238	54	21
Vibrio angustum S14	64	28
Photobacterium profundum SS9	71	28

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
hutW	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -107 score = 5.33368 sequence = TAATAATAGCAATTATCAATT Gene: VCA0909: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake	* Vibrio vulnificus CMCP6 Site: position = -108 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Gene: VV21615: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake	* Vibrio harveyi ATCC BAA-1116 Site: position = -109 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Site: position = -154 score = 5.31682 sequence = TATTGCTAATCATTATCAACT Gene: VIBHAR_05245: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -109 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Gene: VPA0427: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake	* Vibrio shilonii AK1 Site: position = -107 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Gene: VSAK1_22234: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake	* Vibrio splendidus LGP32 Site: position = -108 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Gene: VS_II0290: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake	* Vibrio fischeri ES114 Site: position = -100 score = 5.68017 sequence = TAATGAGATCAATTATCAATT Gene: VF_1226: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake	* Vibrio salmonicida LFI1238 Site: position = -147 score = 5.77431 sequence = AAATGAGATCAATTATCAATT Gene: VSAL_I1750: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -287 score = 5.82117 sequence = AAATAAGATTGATTATCATTT Site: position = -342 score = 5.44464 sequence = GAATAATATCAATTATCATTT Gene: PBPRA2102: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake	Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
huvX	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0908: Putative heme iron utilization protein	Vibrio vulnificus CMCP6 Gene: VV21616: Putative heme iron utilization protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05246: Putative heme iron utilization protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0428: Putative heme iron utilization protein	Vibrio shilonii AK1 Gene: VSAK1_22239: Putative heme iron utilization protein	Vibrio splendidus LGP32 Gene: VS_II0291: Putative heme iron utilization protein	Vibrio fischeri ES114 Gene: VF_1227: Putative heme iron utilization protein	Vibrio salmonicida LFI1238 Gene: VSAL_I1749: Putative heme iron utilization protein	* Vibrio angustum S14 Site: position = -206 score = 5.44464 sequence = GAATAATATCAATTATCATTT Gene: VAS14_03953: Putative heme iron utilization protein	Photobacterium profundum SS9 Gene: PBPRA2101: Putative heme iron utilization protein	Putative heme iron utilization protein
hutZ	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0907: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Vibrio vulnificus CMCP6 Gene: VV21617: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05247: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0429: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Vibrio shilonii AK1 Gene: VSAK1_22244: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Vibrio splendidus LGP32 Gene: VS_II0292: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Vibrio fischeri ES114 Gene: VF_1228: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Vibrio salmonicida LFI1238 Gene: VSAL_I1748: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Vibrio angustum S14 Gene: VAS14_03948: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Photobacterium profundum SS9 Gene: PBPRA2100: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ	Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ

CRON 2.
feoA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -46 score = 5.05628 sequence = TAATAGTAATATTTCTTATTA Gene: VC2078: Ferrous iron transport protein A	* Vibrio vulnificus CMCP6 Site: position = -42 score = 5.46965 sequence = TAATAAAAATATTTCTCATTT Gene: VV1_0149: Ferrous iron transport protein A	* Vibrio harveyi ATCC BAA-1116 Site: position = -42 score = 5.70954 sequence = TAATAATAATATTTATCATTA Gene: VIBHAR_01363: Ferrous iron transport protein A	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -36 score = 4.40561 sequence = TAATATTTATCATTAGCAATA Site: position = -42 score = 5.80368 sequence = AAATAATAATATTTATCATTA Gene: VP0857: Ferrous iron transport protein A	* Vibrio shilonii AK1 Site: position = -45 score = 5.20311 sequence = TAATGTTAATATTTCTCATTA Gene: VSAK1_09003: Ferrous iron transport protein A	* Vibrio splendidus LGP32 Site: position = -42 score = 5.03381 sequence = TAATAACAATCTTTCTCATTA Gene: VS_2234: Ferrous iron transport protein A	* Vibrio fischeri ES114 Site: position = -35 score = 5.68968 sequence = AAATAATAATGATTCTCACTA Gene: VF_0833: Ferrous iron transport protein A	* Vibrio salmonicida LFI1238 Site: position = -35 score = 5.68968 sequence = AAATAATAATGATTCTCACTA Gene: VSAL_I2257: Ferrous iron transport protein A	* Vibrio angustum S14 Site: position = -36 score = 5.82114 sequence = AAATGCTAATAATTCTTATTA Gene: VAS14_17796: Ferrous iron transport protein A	* Photobacterium profundum SS9 Site: position = -36 score = 5.62849 sequence = AAATACTAATAATTCTTATTA Gene: PBPRA1058: Ferrous iron transport protein A	Ferrous iron transport protein A
feoB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC2077: Ferrous iron transport protein B	Vibrio vulnificus CMCP6 Gene: VV1_0148: Ferrous iron transport protein B	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01364: Ferrous iron transport protein B	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0858: Ferrous iron transport protein B	Vibrio shilonii AK1 Gene: VSAK1_09008: Ferrous iron transport protein B	Vibrio splendidus LGP32 Gene: VS_2233: Ferrous iron transport protein B	Vibrio fischeri ES114 Gene: VF_0834: Ferrous iron transport protein B	Vibrio salmonicida LFI1238 Gene: VSAL_I2258: Ferrous iron transport protein B	2 Vibrio angustum S14* Site: position = -82 score = 5.14923 sequence = AAGTGATAAGCGATATCATTT Gene: VAS14_04118: Ferrous iron transport protein B Gene: VAS14_17801: Ferrous iron transport protein B	Photobacterium profundum SS9 Gene: PBPRA1059: Ferrous iron transport protein B	Ferrous iron transport protein B
feoC	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC2076: Ferrous iron transport protein C	Vibrio vulnificus CMCP6 Gene: VV1_0147: Ferrous iron transport protein C	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01365: Ferrous iron transport protein C	Vibrio parahaemolyticus RIMD 2210633 Gene: VP0859: Ferrous iron transport protein C	Vibrio shilonii AK1 Gene: VSAK1_09013: Ferrous iron transport protein C	Vibrio splendidus LGP32 Gene: VS_2232: Ferrous iron transport protein C	Vibrio fischeri ES114 Gene: VF_0835: Ferrous iron transport protein C	Vibrio salmonicida LFI1238 Gene: VSAL_I2259: Ferrous iron transport protein C	2 Vibrio angustum S14 Gene: VAS14_17806: Ferrous iron transport protein C Gene: VAS14_04123: Ferrous iron transport protein C	Photobacterium profundum SS9 Gene: PBPRA1060: Ferrous iron transport protein C	Ferrous iron transport protein C

CRON 3.
COG3315	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 10 score = 4.92067 sequence = ATTTGAGATTCATTATCATCT Site: position = -23 score = 4.36134 sequence = TGTTGAGATAAATTCTCAACA Gene: VC0091: O-Methyltransferase involved in polyketide biosynthesis	* Vibrio vulnificus CMCP6 Site: position = -55 score = 5.86572 sequence = AATTGAGATTTATTATCATTA Gene: VV1_1167: O-Methyltransferase involved in polyketide biosynthesis	* Vibrio harveyi ATCC BAA-1116 Site: position = -57 score = 5.47382 sequence = TATTGAGATTTATTATCATCT Gene: VIBHAR_00267: O-Methyltransferase involved in polyketide biosynthesis	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -2 score = 5.56521 sequence = AATTGATATTCATTATCATCT Gene: VP2944: O-Methyltransferase involved in polyketide biosynthesis	* Vibrio shilonii AK1 Site: position = -2 score = 5.53584 sequence = AAATGACATTAGTTATCATTT Gene: VSAK1_13246: O-Methyltransferase involved in polyketide biosynthesis	* Vibrio splendidus LGP32 Site: position = -43 score = 5.56521 sequence = AATTGATATTCATTATCATCT Site: position = -76 score = 5.1063 sequence = TATTGATATTTACTCTCAATA Gene: VS_3005: O-Methyltransferase involved in polyketide biosynthesis	* Vibrio fischeri ES114 Site: position = -47 score = 5.86303 sequence = TAATGATAGTTATTATCATTT Site: position = -53 score = 4.37104 sequence = AAGTGGTAATGATAGTTATTA Gene: VF_2441: O-Methyltransferase involved in polyketide biosynthesis	* Vibrio salmonicida LFI1238 Site: position = -34 score = 5.37394 sequence = TAATGATAGTCATTATCATCT Site: position = -40 score = 4.71569 sequence = AATTGGTAATGATAGTCATTA Gene: VSAL_I2892: O-Methyltransferase involved in polyketide biosynthesis	* Vibrio angustum S14 Site: position = -42 score = 5.65981 sequence = AACTGATAATTATTATCATCT Gene: VAS14_21832: O-Methyltransferase involved in polyketide biosynthesis	* Photobacterium profundum SS9 Site: position = -45 score = 5.37394 sequence = TAATGATAGTCATTATCATCT Gene: PBPRA0166: O-Methyltransferase involved in polyketide biosynthesis	O-Methyltransferase involved in polyketide biosynthesis

CRON 4.
irgB	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -131 score = 6.03303 sequence = AAATGATAATTATTCTTAATT Gene: VC0474: Iron-regulated virulence regulatory protein irgB	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_07055: Iron-regulated virulence regulatory protein irgB	3 Vibrio parahaemolyticus RIMD 2210633* Site: position = -124 score = 6.03029 sequence = AATTGATAATGATTATTATTT Gene: VP2603: Iron-regulated virulence regulatory protein irgB Gene: VPA1747: Iron-regulated virulence regulatory protein irgB Gene: VPA0912: Iron-regulated virulence regulatory protein irgB	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0791: Iron-regulated virulence regulatory protein irgB	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_11319: Iron-regulated virulence regulatory protein irgB	Photobacterium profundum SS9	Iron-regulated virulence regulatory protein irgB

CRON 5.
COG0778	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV1_3131: Nitroreductase	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_03042: Nitroreductase	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2150: Nitroreductase	* Vibrio shilonii AK1 Site: position = -87 score = 5.07431 sequence = GATTGAGAACAGTTCTCACTT Gene: VSAK1_03499: Nitroreductase	* Vibrio splendidus LGP32 Site: position = -76 score = 4.54844 sequence = CGTTGAGATTTATTATCGTTT Gene: VS_0939: Nitroreductase	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -30 score = 5.26267 sequence = AAAAAATAACTATTTTCATTT Gene: VAS14_05758: Nitroreductase	* Photobacterium profundum SS9 Site: position = -19 score = 4.34448 sequence = TTGTAAGAGCAATTATTATTT Gene: PBPRA2593: Nitroreductase	Nitroreductase

CRON 6.
COG4771	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01404: Outer membrane receptor for ferrienterochelin, TonB-dependent	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -39 score = 5.77725 sequence = AAATGCAAACTATTATCATTT Gene: VSAK1_03309: Outer membrane receptor for ferrienterochelin, TonB-dependent	* Vibrio splendidus LGP32 Site: position = -88 score = 5.53559 sequence = AAATGATAACCATTACTATTA Gene: VS_2395: Outer membrane receptor for ferrienterochelin, TonB-dependent	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -43 score = 5.50187 sequence = TAACGATAATAATTATCATTC Gene: PBPRB1825: Outer membrane receptor for ferrienterochelin, TonB-dependent	Outer membrane receptor for ferrienterochelin, TonB-dependent

CRON 7.
irpA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -2 score = 5.81164 sequence = AAATGATAATAATTTGCAATT Gene: VC1264: Iron-regulated protein A precursor	* Vibrio vulnificus CMCP6 Site: position = -38 score = 5.51797 sequence = AAATAAGAATAATTAGCACTA Gene: VV1_2968: Iron-regulated protein A precursor	* Vibrio harveyi ATCC BAA-1116 Site: position = -51 score = 5.51797 sequence = AAATAAGAATAATTAGCACTA Gene: VIBHAR_02715: Iron-regulated protein A precursor	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -33 score = 5.51797 sequence = AAATAAGAATAATTAGCACTA Gene: VP1920: Iron-regulated protein A precursor	* Vibrio shilonii AK1 Site: position = -55 score = 5.71061 sequence = AAATGATAATAATTCGCACTA Gene: VSAK1_04580: Iron-regulated protein A precursor	* Vibrio splendidus LGP32 Site: position = -61 score = 5.28274 sequence = AAATGATAATGGTTTGCACTA Gene: VS_1923: Iron-regulated protein A precursor	* Vibrio fischeri ES114 Site: position = -132 score = 5.39528 sequence = AAATGATAAGGATTTGCATTT Site: position = -87 score = 5.94493 sequence = AAATAAAAATTATTATCATTA Gene: VF_1190: Iron-regulated protein A precursor	* Vibrio salmonicida LFI1238 Site: position = -83 score = 5.70043 sequence = AAATAACAATAATTATCATTA Site: position = -128 score = 5.48784 sequence = TAATGATAAATATTTGCATTT Gene: VSAL_I1786: Iron-regulated protein A precursor	* Vibrio angustum S14 Site: position = -73 score = 5.69578 sequence = TAATAATAACAATTATCACTT Site: position = -141 score = 5.5025 sequence = AAATGCAAATTATTACCATTA Gene: VAS14_01246: Iron-regulated protein A precursor	Photobacterium profundum SS9	Iron-regulated protein A precursor

CRON 8.
viuP	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -2 score = 4.87378 sequence = AAATGAGAATCAATATTACAA Site: position = 16 score = 4.79459 sequence = CAATGAAAAACATTTTTATTT Gene: VC0776: Ferric vibriobactin, enterobactin transport system, substrate-binding protein ViuP (TC 3.A.1.14.6)	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -98 score = 4.97029 sequence = AAATGAGAATCAATGTAATTT Gene: VS_1123: Ferric vibriobactin, enterobactin transport system, substrate-binding protein ViuP (TC 3.A.1.14.6)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Ferric vibriobactin, enterobactin transport system, substrate-binding protein ViuP (TC 3.A.1.14.6)
viuD	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0777: Ferric vibriobactin, enterobactin transport system, permease protein ViuD (TC 3.A.1.14.6)	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1124: Ferric vibriobactin, enterobactin transport system, permease protein ViuD (TC 3.A.1.14.6)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Ferric vibriobactin, enterobactin transport system, permease protein ViuD (TC 3.A.1.14.6)
viuG	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0778: Ferric vibriobactin, enterobactin transport system, permease protein ViuG (TC 3.A.1.14.6)	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1125: Ferric vibriobactin, enterobactin transport system, permease protein ViuG (TC 3.A.1.14.6)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Ferric vibriobactin, enterobactin transport system, permease protein ViuG (TC 3.A.1.14.6)

CRON 9.
VPA0663	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -2 score = 5.38 sequence = TAATGATAATAATTCTCAGGT Gene: VPA0663: putative transcriptional regulator, AraC/XylS family	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -2 score = 5.93749 sequence = AAATGATAATAATTATCAATC Gene: VS_II0528: putative transcriptional regulator, AraC/XylS family	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	putative transcriptional regulator, AraC/XylS family

CRON 10.
COG2910	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = -46 score = 4.48214 sequence = TGATGTAAAGTATTCTCATTA Gene: VIBHAR_02532: Putative NADH-flavin reductase	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -18 score = 4.57373 sequence = AAATTATTATCATTATCAATG Site: position = -24 score = 5.13564 sequence = TAGTGTAAATTATTATCATTA Gene: VSAK1_01252: Putative NADH-flavin reductase	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -48 score = 5.58897 sequence = TAATGCAAACTATTATCATTA Gene: VAS14_10719: Putative NADH-flavin reductase	* Photobacterium profundum SS9 Site: position = -46 score = 4.55338 sequence = TAATACGAATTAGAATCATTA Gene: PBPRB1864: Putative NADH-flavin reductase	Putative NADH-flavin reductase

CRON 11.
PF07690	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1 Gene: VSAK1_20934: MFS transporter	* Vibrio splendidus LGP32 Site: position = -49 score = 4.39733 sequence = AAATCAAAATGATAATTATTC Site: position = -43 score = 4.72169 sequence = AAATGATAATTATTCGCTAAA Gene: VS_2111: MFS transporter	* Vibrio fischeri ES114 Site: position = -76 score = 5.56229 sequence = TAATGATAATTATTTTTATTC Site: position = -82 score = 5.01397 sequence = AAATGTTAATGATAATTATTT Gene: VF_A0157: MFS transporter	* Vibrio salmonicida LFI1238 Site: position = -150 score = 4.56715 sequence = AAATAGTAATGATAATTGTTT Site: position = -144 score = 5.37674 sequence = TAATGATAATTGTTTTTATTC Gene: VSAL_II0149: MFS transporter	Vibrio angustum S14	Photobacterium profundum SS9	MFS transporter

CRON 12.
VSAK1_18252	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -78 score = 6.27995 sequence = TAATGATAATGATTATCATTT Site: position = -72 score = 4.52617 sequence = TAATGATTATCATTTTAATCT Gene: VSAK1_18252: TonB-dependent heme receptor	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	TonB-dependent heme receptor

CRON 13.
VPA0882	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -80 score = 5.67039 sequence = TAATGATAGTAATTATTATTT Site: position = -64 score = 4.41889 sequence = TATTTAGATCCATTAACATTT Site: position = -86 score = 4.67356 sequence = AAATGATAATGATAGTAATTA Gene: VPA0882: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor

CRON 14.
vctP	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 28 score = 4.87655 sequence = TAATGAGAATAAGTATCAAAA Gene: VCA0227: iron(III) ABC transporter, periplasmic iron-compound-binding protein	Vibrio vulnificus CMCP6 Gene: VV20842: iron(III) ABC transporter, periplasmic iron-compound-binding protein	* Vibrio harveyi ATCC BAA-1116 Site: position = -31 score = 4.68282 sequence = GCATGATAACGGATCTCATTA Gene: VIBHAR_06135: iron(III) ABC transporter, periplasmic iron-compound-binding protein	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -33 score = 4.96556 sequence = GCATGATAATAGATCTCATTA Gene: VPA0657: iron(III) ABC transporter, periplasmic iron-compound-binding protein	* Vibrio shilonii AK1 Site: position = -79 score = 5.64765 sequence = AAATGATATTGATTCCCATTT Site: position = -52 score = 4.69244 sequence = AAGTGATAATGATTCTGTTTA Gene: VSAK1_21214: iron(III) ABC transporter, periplasmic iron-compound-binding protein	* Vibrio splendidus LGP32 Site: position = -129 score = 5.73695 sequence = AATTGATAATAGTTCTCACTT Gene: VS_II1071: iron(III) ABC transporter, periplasmic iron-compound-binding protein	* Vibrio fischeri ES114 Site: position = -65 score = 5.56805 sequence = TAATAATAACCATTTTCATTA Site: position = -34 score = 5.42656 sequence = AAATACGAATAGTTATCACTT Gene: VF_A0827: iron(III) ABC transporter, periplasmic iron-compound-binding protein	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	iron(III) ABC transporter, periplasmic iron-compound-binding protein
vctD	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0228: Iron(III) ABC transporter, permease protein	Vibrio vulnificus CMCP6 Gene: VV20110: Iron(III) ABC transporter, permease protein	2 Vibrio harveyi ATCC BAA-1116* Site: position = -320 score = 5.06617 sequence = TGATAGGATTAATTATCATTT Gene: VIBHAR_02108: Iron(III) ABC transporter, permease protein Gene: VIBHAR_06134: Iron(III) ABC transporter, permease protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0658: Iron(III) ABC transporter, permease protein	Vibrio shilonii AK1 Gene: VSAK1_21219: Iron(III) ABC transporter, permease protein	Vibrio splendidus LGP32 Gene: VS_II1070: Iron(III) ABC transporter, permease protein	Vibrio fischeri ES114 Gene: VF_A0826: Iron(III) ABC transporter, permease protein	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Iron(III) ABC transporter, permease protein
vctB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0229: Iron(III) ABC transporter, permease protein	Vibrio vulnificus CMCP6 Gene: VV20111: Iron(III) ABC transporter, permease protein	2 Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02107: Iron(III) ABC transporter, permease protein Gene: VIBHAR_06133: Iron(III) ABC transporter, permease protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0659: Iron(III) ABC transporter, permease protein	Vibrio shilonii AK1 Gene: VSAK1_21224: Iron(III) ABC transporter, permease protein	Vibrio splendidus LGP32 Gene: VS_II1068: Iron(III) ABC transporter, permease protein	Vibrio fischeri ES114 Gene: VF_A0825: Iron(III) ABC transporter, permease protein	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Iron(III) ABC transporter, permease protein
vctC	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0230: Iron(III) ABC transporter, ATP-binding protein	Vibrio vulnificus CMCP6 Gene: VV20112: Iron(III) ABC transporter, ATP-binding protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06132: Iron(III) ABC transporter, ATP-binding protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0660: Iron(III) ABC transporter, ATP-binding protein	Vibrio shilonii AK1 Gene: VSAK1_21229: Iron(III) ABC transporter, ATP-binding protein	Vibrio splendidus LGP32 Gene: VS_II1067: Iron(III) ABC transporter, ATP-binding protein	Vibrio fischeri ES114 Gene: VF_A0824: Iron(III) ABC transporter, ATP-binding protein	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Iron(III) ABC transporter, ATP-binding protein
viuB	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = 4 score = 4.42241 sequence = GAAAGAGAATTGTTATCAAAA Gene: VIBHAR_06920: Siderophore-interacting protein ViuB	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0089: Siderophore-interacting protein ViuB	* Vibrio shilonii AK1 Site: position = -31 score = 5.38917 sequence = AAATGAAAACAATAATCATTA Gene: VSAK1_05955: Siderophore-interacting protein ViuB	* Vibrio splendidus LGP32 Site: position = -76 score = 5.2973 sequence = AAATGATAACTATTAGTATTG Gene: VS_II0412: Siderophore-interacting protein ViuB	Vibrio fischeri ES114 Gene: VF_A0823: Siderophore-interacting protein ViuB	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -29 score = 5.51071 sequence = AAATAAAAACCATTCTCAATT Gene: VAS14_04423: Siderophore-interacting protein ViuB	Photobacterium profundum SS9	Siderophore-interacting protein ViuB
VV20841	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -113 score = 5.54227 sequence = AAATGGTAATAATAATCATTT Gene: VV20841: Aryl carrier domain	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Aryl carrier domain

CRON 15.
PF03929	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06750: Uncharacterized protein involved in iron uptake	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -59 score = 4.86504 sequence = CAATAAGAATGATTATCACCT Gene: VPA0157: Uncharacterized protein involved in iron uptake	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -57 score = 4.84533 sequence = CAATACGAATTATTATCAACT Gene: VS_II0685: Uncharacterized protein involved in iron uptake	Vibrio fischeri ES114	* Vibrio salmonicida LFI1238 Site: position = -61 score = 4.69492 sequence = CAACGCAAATCATTATCAATT Gene: VSAL_II0118: Uncharacterized protein involved in iron uptake	* Vibrio angustum S14 Site: position = -61 score = 5.2234 sequence = CAATAAGAACGATTATCAATT Gene: VAS14_12444: Uncharacterized protein involved in iron uptake	* Photobacterium profundum SS9 Site: position = -87 score = 5.27092 sequence = CAATGAAAACGATTATCAATT Gene: PBPRB1213: Uncharacterized protein involved in iron uptake	Uncharacterized protein involved in iron uptake
PF10029	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06749: Predicted periplasmic protein (DUF2271)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0158: Predicted periplasmic protein (DUF2271)	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0686: Predicted periplasmic protein (DUF2271)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0119: Predicted periplasmic protein (DUF2271)	Vibrio angustum S14 Gene: VAS14_12439: Predicted periplasmic protein (DUF2271)	Photobacterium profundum SS9 Gene: PBPRB1212: Predicted periplasmic protein (DUF2271)	Predicted periplasmic protein (DUF2271)
cbiM	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06748: ABC-type Co2+ transport system, periplasmic component	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0159: ABC-type Co2+ transport system, periplasmic component	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0687: ABC-type Co2+ transport system, periplasmic component	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0120: ABC-type Co2+ transport system, periplasmic component	Vibrio angustum S14 Gene: VAS14_12434: ABC-type Co2+ transport system, periplasmic component	Photobacterium profundum SS9 Gene: PBPRB1211: ABC-type Co2+ transport system, periplasmic component	ABC-type Co2+ transport system, periplasmic component
VIBHAR_06747	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06747: conserved hypothetical protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0160: conserved hypothetical protein	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0688: conserved hypothetical protein	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0121: conserved hypothetical protein	Vibrio angustum S14 Gene: VAS14_12429: conserved hypothetical protein	Photobacterium profundum SS9 Gene: PBPRB1210: conserved hypothetical protein	conserved hypothetical protein
VIBHAR_06746	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06746: conserved hypothetical protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0161: conserved hypothetical protein	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0689: conserved hypothetical protein	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0122: conserved hypothetical protein	Vibrio angustum S14 Gene: VAS14_12424: conserved hypothetical protein	Photobacterium profundum SS9 Gene: PBPRB1209: conserved hypothetical protein	conserved hypothetical protein
PF01297	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06745: ABC transporter, metal-binding lipoprotein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0162: ABC transporter, metal-binding lipoprotein	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0690: ABC transporter, metal-binding lipoprotein	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0123: ABC transporter, metal-binding lipoprotein	Vibrio angustum S14 Gene: VAS14_12419: ABC transporter, metal-binding lipoprotein	Photobacterium profundum SS9 Gene: PBPRB1208: ABC transporter, metal-binding lipoprotein	ABC transporter, metal-binding lipoprotein
COG1121	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06744: ABC-type Mn/Zn transport systems, ATPase component	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0163: ABC-type Mn/Zn transport systems, ATPase component	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0691: ABC-type Mn/Zn transport systems, ATPase component	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0124: ABC-type Mn/Zn transport systems, ATPase component	Vibrio angustum S14 Gene: VAS14_12414: ABC-type Mn/Zn transport systems, ATPase component	Photobacterium profundum SS9 Gene: PBPRB1207: ABC-type Mn/Zn transport systems, ATPase component	ABC-type Mn/Zn transport systems, ATPase component
COG1108	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06743: ABC-type Mn2+/Zn2+ transport systems, permease components	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0164: ABC-type Mn2+/Zn2+ transport systems, permease components	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0692: ABC-type Mn2+/Zn2+ transport systems, permease components	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0125: ABC-type Mn2+/Zn2+ transport systems, permease components	Vibrio angustum S14 Gene: VAS14_12409: ABC-type Mn2+/Zn2+ transport systems, permease components	Photobacterium profundum SS9 Gene: PBPRB1206: ABC-type Mn2+/Zn2+ transport systems, permease components	ABC-type Mn2+/Zn2+ transport systems, permease components
COG0803	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06742: ABC-type metal ion transport system, periplasmic component/surface adhesin	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0165: ABC-type metal ion transport system, periplasmic component/surface adhesin	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0693: ABC-type metal ion transport system, periplasmic component/surface adhesin	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: VSAL_II0126: ABC-type metal ion transport system, periplasmic component/surface adhesin	Vibrio angustum S14 Gene: VAS14_12404: ABC-type metal ion transport system, periplasmic component/surface adhesin	Photobacterium profundum SS9 Gene: PBPRB1205: ABC-type metal ion transport system, periplasmic component/surface adhesin	ABC-type metal ion transport system, periplasmic component/surface adhesin

CRON 16.
COG2132	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -183 score = 5.20449 sequence = TGTTGAGAATGATTATTAATA Gene: VV1_0966: Multicopper oxidase	* Vibrio harveyi ATCC BAA-1116 Site: position = -65 score = 5.42212 sequence = AACTGAGAATCATTATTAATA Gene: VIBHAR_00368: Multicopper oxidase	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -44 score = 4.83638 sequence = AATTGAGAATCATTATCTAAT Gene: VSAK1_24319: Multicopper oxidase	* Vibrio splendidus LGP32 Site: position = -62 score = 5.39285 sequence = TTATGAGAATTATTCTCAATA Gene: VS_3101: Multicopper oxidase	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Multicopper oxidase

CRON 17.
nrfA	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV1_3035: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02727: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1929: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit	* Vibrio shilonii AK1 Site: position = -241 score = 5.71943 sequence = AAATGATAATTAATATCATCA Gene: VSAK1_05600: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit	* Vibrio splendidus LGP32 Site: position = -281 score = 5.40717 sequence = ATATGATAATAATTCTCAGTT Gene: VS_1933: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit	* Vibrio fischeri ES114 Site: position = -226 score = 5.5546 sequence = AAATAAGAATCATTCTTAATA Gene: VF_1554: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit	* Vibrio salmonicida LFI1238 Site: position = -227 score = 5.4635 sequence = AAATAAGAACCATTATTAATA Gene: VSAL_I1997: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRA1258: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit	Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit

CRON 18.
sodA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -37 score = 6.01719 sequence = TAATGATATTAATTATCATTA Gene: VC2694: Manganese superoxide dismutase (EC 1.15.1.1)	* Vibrio vulnificus CMCP6 Site: position = -58 score = 5.55134 sequence = AGTTGATAATGGTTATCATTA Gene: VV1_1252: Manganese superoxide dismutase (EC 1.15.1.1)	* Vibrio harveyi ATCC BAA-1116 Site: position = -51 score = 4.75251 sequence = TAATGATTTTCATTAACATTA Site: position = -57 score = 5.49732 sequence = AGTTGATAATGATTTTCATTA Gene: VIBHAR_00151: Manganese superoxide dismutase (EC 1.15.1.1)	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -58 score = 4.9832 sequence = AGTTGATAATGACTTTCATTA Gene: VP2860: Manganese superoxide dismutase (EC 1.15.1.1)	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -58 score = 5.13115 sequence = AGTTGATAATGATTTCCATTA Site: position = -52 score = 5.17159 sequence = TAATGATTTCCATTATCATTA Gene: VS_2918: Manganese superoxide dismutase (EC 1.15.1.1)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -55 score = 6.09746 sequence = TAATGATAATAGTTATCATTA Gene: VAS14_05603: Manganese superoxide dismutase (EC 1.15.1.1)	* Photobacterium profundum SS9 Site: position = -54 score = 5.40553 sequence = TAATGCGAGTAATTATCATTA Gene: PBPRA2569: Manganese superoxide dismutase (EC 1.15.1.1)	Manganese superoxide dismutase (EC 1.15.1.1)
PF10952	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -53 score = 5.83701 sequence = ACATGATAATAATTATCAATT Gene: VC1009: Protein of unknown function (DUF2753)	* Vibrio vulnificus CMCP6 Site: position = -56 score = 5.74859 sequence = ACATGATAATAATTTTCATTT Gene: VV1_3101: Protein of unknown function (DUF2753)	* Vibrio harveyi ATCC BAA-1116 Site: position = -58 score = 5.34437 sequence = ACTTGATAATAATTATCGTTT Gene: VIBHAR_02989: Protein of unknown function (DUF2753)	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -57 score = 5.34437 sequence = ACTTGATAATAATTATCGTTT Gene: VP2110: Protein of unknown function (DUF2753)	* Vibrio shilonii AK1 Site: position = -148 score = 4.99466 sequence = AAATGATAATCGTTATCGAAT Site: position = -55 score = 5.71637 sequence = AAATGATAATCAATATCATCT Gene: VSAK1_20819: Protein of unknown function (DUF2753)	* Vibrio splendidus LGP32 Site: position = -56 score = 5.98817 sequence = ACATGATAATAATTATCATTT Site: position = -105 score = 4.37369 sequence = AATCGATATTCTTTACTAATT Site: position = -112 score = 4.60763 sequence = TATTAATAATCGATATTCTTT Gene: VS_0969: Protein of unknown function (DUF2753)	* Vibrio fischeri ES114 Site: position = -70 score = 5.8061 sequence = AATTGATAATAATTCTCAGTT Gene: VF_0927: Protein of unknown function (DUF2753)	* Vibrio salmonicida LFI1238 Site: position = -61 score = 6.13153 sequence = TAATGATAATAATTCTCAATT Gene: VSAL_I1864: Protein of unknown function (DUF2753)	Vibrio angustum S14 Gene: VAS14_05608: Protein of unknown function (DUF2753)	Photobacterium profundum SS9 Gene: PBPRA2570: Protein of unknown function (DUF2753)	Protein of unknown function (DUF2753)

CRON 19.
VSAK1_04950	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -108 score = 5.84242 sequence = AAATGATAATAAATAGCATTA Gene: VSAK1_04950: TonB-dependent siderophore receptor	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -27 score = 5.6407 sequence = AAATGATAATTCATCTCATTT Gene: VAS14_12284: TonB-dependent siderophore receptor	Photobacterium profundum SS9	TonB-dependent siderophore receptor

CRON 20.
VIBHAR_03036	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = -41 score = 5.73806 sequence = AATTGATAATGATTTTCAATA Site: position = -35 score = 5.0343 sequence = TAATGATTTTCAATATCAATT Gene: VIBHAR_03036: hypothetical protein	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	hypothetical protein
PF00106	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_03037: Short chain dehydrogenase	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -204 score = 5.88922 sequence = AATTGATAATGATTTTCATTA Gene: VP2146: Short chain dehydrogenase	Vibrio shilonii AK1 Gene: VSAK1_03509: Short chain dehydrogenase	* Vibrio splendidus LGP32 Site: position = -197 score = 6.09746 sequence = TAATGATAATAGTTATCATTA Gene: VS_0942: Short chain dehydrogenase	Vibrio fischeri ES114 Gene: VF_1658: Short chain dehydrogenase	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -128 score = 6.07483 sequence = AATTGATAATTATTATCAATA Gene: VAS14_10544: Short chain dehydrogenase	Photobacterium profundum SS9	Short chain dehydrogenase

CRON 21.
hutA	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV20276: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor	* Vibrio harveyi ATCC BAA-1116 Site: position = -81 score = 5.20837 sequence = GAATGATAGTAATTACCATTT Gene: VIBHAR_05789: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor

CRON 22.
fhuA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -54 score = 5.23312 sequence = AATTGAGAAAGATTCGCAATT Site: position = -24 score = 4.49305 sequence = TAATTAAGATAATTATCACTA Gene: VC0200: TonB-dependent outer membrane receptor for iron siderophores	* Vibrio vulnificus CMCP6 Site: position = -47 score = 5.40242 sequence = AAATGAGAATTACTACCATTA Gene: VV21337: TonB-dependent outer membrane receptor for iron siderophores	* Vibrio harveyi ATCC BAA-1116 Site: position = -48 score = 5.55221 sequence = AAATGAGATTTATTACTATTT Gene: VIBHAR_06299: TonB-dependent outer membrane receptor for iron siderophores	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -57 score = 5.45153 sequence = AAATGATAATAATTACAATTA Gene: VPA1435: TonB-dependent outer membrane receptor for iron siderophores	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -49 score = 5.55221 sequence = AAATGAGATTTATTACTATTT Gene: VS_II0501: TonB-dependent outer membrane receptor for iron siderophores	* Vibrio fischeri ES114 Site: position = -55 score = 4.72857 sequence = GCAAGAGAATCATTCTCATTT Gene: VF_A0784: TonB-dependent outer membrane receptor for iron siderophores	* Vibrio salmonicida LFI1238 Site: position = -56 score = 4.72857 sequence = GCAAGAGAATCATTCTCATTT Gene: VSAL_II0909: TonB-dependent outer membrane receptor for iron siderophores	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -138 score = 4.71786 sequence = CAATGATAGTAGTTATCATTG Gene: PBPRA1566: TonB-dependent outer membrane receptor for iron siderophores	TonB-dependent outer membrane receptor for iron siderophores
fhuC	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0201: Ferrichrome transport ATP-binding protein FhuC	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06304: Ferrichrome transport ATP-binding protein FhuC	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1436: Ferrichrome transport ATP-binding protein FhuC	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0498: Ferrichrome transport ATP-binding protein FhuC	Vibrio fischeri ES114 Gene: VF_A0783: Ferrichrome transport ATP-binding protein FhuC	Vibrio salmonicida LFI1238 Gene: VSAL_II0908: Ferrichrome transport ATP-binding protein FhuC	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRA1565: Ferrichrome transport ATP-binding protein FhuC	Ferrichrome transport ATP-binding protein FhuC
fhuD	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0202: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06298: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1437: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0502: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)	Vibrio fischeri ES114 Gene: VF_A0782: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRA1564: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)	Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
fhuB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0203: Ferrichrome transport system permease protein FhuB	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06297: Ferrichrome transport system permease protein FhuB	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1438: Ferrichrome transport system permease protein FhuB	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0503: Ferrichrome transport system permease protein FhuB	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRA1563: Ferrichrome transport system permease protein FhuB	Ferrichrome transport system permease protein FhuB

CRON 23.
VSAK1_14737	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -108 score = 4.59226 sequence = AGATGAAAATAATTGCCACTA Site: position = -77 score = 5.40116 sequence = AAATGATAGTAATTCGTATTT Gene: VSAK1_14737: TonB-dependent hemin , ferrichrome receptor	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -80 score = 5.46454 sequence = AAATGATAGTAATTATCGTTT Gene: VAS14_03678: TonB-dependent hemin , ferrichrome receptor	Photobacterium profundum SS9	TonB-dependent hemin , ferrichrome receptor
VCA0575	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -178 score = 5.67749 sequence = TAATGATAATTGCTATCATTT Gene: VCA0575: Transcriptional regulator, LysR family	* Vibrio vulnificus CMCP6 Site: position = -145 score = 5.48039 sequence = TAATGATAATTACTATCATTC Gene: VV20277: Transcriptional regulator, LysR family	* Vibrio harveyi ATCC BAA-1116 Site: position = -173 score = 5.20837 sequence = AAATGGTAATTACTATCATTC Gene: VIBHAR_05788: Transcriptional regulator, LysR family	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -189 score = 4.41889 sequence = AAATGTTAATGGATCTAAATA Site: position = -173 score = 5.67039 sequence = AAATAATAATTACTATCATTA Site: position = -167 score = 4.67356 sequence = TAATTACTATCATTATCATTT Gene: VPA0883: Transcriptional regulator, LysR family	Vibrio shilonii AK1 Gene: VSAK1_14742: Transcriptional regulator, LysR family	Vibrio splendidus LGP32 Gene: VS_II0749: Transcriptional regulator, LysR family	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_12529: Transcriptional regulator, LysR family	Photobacterium profundum SS9 Gene: PBPRB0921: Transcriptional regulator, LysR family	Transcriptional regulator, LysR family

CRON 24.
PBPRB1034	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -141 score = 4.92052 sequence = TAATACAAATAATAATTATTT Site: position = -135 score = 5.94493 sequence = AAATAATAATTATTTTCATTA Gene: PBPRB1034: hypothetical protein	hypothetical protein
PBPRB1033	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1033: hypothetical protein	hypothetical protein
PBPRB1032	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1032: High-affinity iron permease	High-affinity iron permease
PBPRB1031	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1031: BarJ	BarJ
PBPRB1030	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1030: hypothetical protein	hypothetical protein
PBPRB1029	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1029: hypothetical protein	hypothetical protein

CRON 25.
fepB	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = -95 score = 4.97582 sequence = TATTGATATTACTTCTCAGTT Gene: VIBHAR_06007: ABC-type Fe3+-siderophores transport systems, periplasmic component	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -76 score = 4.43217 sequence = TAATAGTATTGATAACCATTA Site: position = -70 score = 5.25796 sequence = TATTGATAACCATTATTGTTT Gene: VSAK1_22029: ABC-type Fe3+-siderophores transport systems, periplasmic component	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	ABC-type Fe3+-siderophores transport systems, periplasmic component
fepD	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	2 Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06009: ABC-type Fe3+-siderophore transport system, permease component Gene: VIBHAR_06008: ABC-type Fe3+-siderophore transport system, permease component	Vibrio parahaemolyticus RIMD 2210633	2 Vibrio shilonii AK1 Gene: VSAK1_22024: ABC-type Fe3+-siderophore transport system, permease component Gene: VSAK1_22019: ABC-type Fe3+-siderophore transport system, permease component	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	ABC-type Fe3+-siderophore transport system, permease component
fepC	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06010: ABC-type Fe3+-siderophores transport system, ATPase component	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1 Gene: VSAK1_22014: ABC-type Fe3+-siderophores transport system, ATPase component	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	ABC-type Fe3+-siderophores transport system, ATPase component
fepA	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06011: TonB-dependent ferric achromobactin receptor	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -60 score = 5.54018 sequence = AAATAATATTTGTTCTTATTT Gene: VPA1657: TonB-dependent ferric achromobactin receptor	* Vibrio shilonii AK1 Site: position = -69 score = 5.24505 sequence = TATTGATAACTATTATCAAAA Gene: VSAK1_22009: TonB-dependent ferric achromobactin receptor	* Vibrio splendidus LGP32 Site: position = -60 score = 5.35018 sequence = AAATGATATTTGTTCTTATTC Gene: VS_II1128: TonB-dependent ferric achromobactin receptor	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -70 score = 5.56549 sequence = AAGTGATAATTATTTGCATTA Gene: VAS14_15544: TonB-dependent ferric achromobactin receptor	Photobacterium profundum SS9	TonB-dependent ferric achromobactin receptor

CRON 26.
iucA	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	* Vibrio fischeri ES114 Site: position = -52 score = 5.53394 sequence = TAATGAGAATCATTAGCATTC Gene: VF_A0161: aerobactin siderophore biosynthesis protein IucA	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	aerobactin siderophore biosynthesis protein IucA
iucB	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0162: aerobactin siderophore synthesis protein IucB	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	N(6)-hydroxylysine O-acetyltransferase
iucC	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0163: aerobactin siderophore biosynthesis protein IucC	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	siderophore biosynthesis IucC protein
iucD	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0164: aerobactin siderophore biosynthesis protein IucD	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	L-lysine 6-monooxygenase
iutA	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -145 score = 5.2775 sequence = AAAAGAAAATAATTCGCATTT Site: position = -97 score = 5.27911 sequence = CAATAATAACAATTCTTATTT Gene: VV21016: Aerobactin siderophore receptor IutA,TonB-dependent	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -55 score = 5.08835 sequence = TATTGATAATAAGTATCATTG Gene: VPA0979: Aerobactin siderophore receptor IutA,TonB-dependent	* Vibrio shilonii AK1 Site: position = -112 score = 5.91248 sequence = AAATAGTAATAATTATCATTT Gene: VSAK1_20974: Aerobactin siderophore receptor IutA,TonB-dependent	* Vibrio splendidus LGP32 Site: position = -298 score = 5.36747 sequence = CAATAATAATGATTCTTATTT Site: position = -263 score = 4.55501 sequence = TAACGATAATACTTCGTACTT Gene: VS_2116: Aerobactin siderophore receptor IutA,TonB-dependent	* Vibrio fischeri ES114 Site: position = -62 score = 4.46405 sequence = GAATACGGATTTTTATCATTT Gene: VF_A0165: Aerobactin siderophore receptor IutA,TonB-dependent	Vibrio salmonicida LFI1238 Gene: VSAL_II0279: Aerobactin siderophore receptor IutA,TonB-dependent	Vibrio angustum S14	Photobacterium profundum SS9	Aerobactin siderophore receptor IutA,TonB-dependent

CRON 27.
VV20839	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -133 score = 5.53886 sequence = TAATGATATACATTCTCATTT Gene: VV20839: Isochorismate pyruvate-lyase of siderophore biosynthesis # Vulnibactin-specific	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Isochorismate pyruvate-lyase of siderophore biosynthesis # Vulnibactin-specific
VC0771	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -167 score = 6.09309 sequence = AAATGATAATTGTTATTATTT Gene: VC0771: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB	Vibrio vulnificus CMCP6 Gene: VV20838: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02097: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB
viuB	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -140 score = 5.53886 sequence = TAATGATATACATTCTCATTT Gene: VC2210: Vibriobactin utilization protein ViuB	Vibrio vulnificus CMCP6 Gene: VV20837: Vibriobactin utilization protein ViuB	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1122: Vibriobactin utilization protein ViuB	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -45 score = 5.85483 sequence = AAATGATAATGGTTTTCATTA Gene: PBPRB1812: Vibriobactin utilization protein ViuB	Vibriobactin utilization protein ViuB

CRON 28.
vibF	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -90 score = 4.36914 sequence = TGATAATGATTATTATTAACT Site: position = -93 score = 5.93615 sequence = AATTGATAATGATTATTATTA Gene: VC2209: nonribosomal peptide synthetase VibF	* Vibrio vulnificus CMCP6 Site: position = -8 score = 6.08731 sequence = AAATGATAATGATTATTATTA Site: position = -176 score = 5.79037 sequence = TAATGATAATTATTATCGTTA Site: position = -182 score = 4.82569 sequence = TAATGTTAATGATAATTATTA Gene: VV20831: nonribosomal peptide synthetase VibF	* Vibrio harveyi ATCC BAA-1116 Site: position = -63 score = 4.41901 sequence = AAATGATTATTGTTTGCAAAA Site: position = -69 score = 4.59931 sequence = TATTGTAAATGATTATTGTTT Gene: VIBHAR_02101: nonribosomal peptide synthetase VibF	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	nonribosomal peptide synthetase VibF
VV20830	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV20830: Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific	* Vibrio harveyi ATCC BAA-1116 Site: position = -111 score = 5.06617 sequence = AAATGATAATTAATCCTATCA Gene: VIBHAR_02109: Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific

CRON 29.
VC0426	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0426: Predicted membrane protein	Vibrio vulnificus CMCP6 Gene: VV1_1471: Predicted membrane protein	* Vibrio harveyi ATCC BAA-1116 Site: position = -60 score = 6.0374 sequence = TAATGATAATAATTCTCAATA Gene: VIBHAR_03638: Predicted membrane protein	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -58 score = 5.07444 sequence = TAATGAGAAGTATTATCGATA Gene: VP2647: Predicted membrane protein	* Vibrio shilonii AK1 Site: position = -70 score = 4.92022 sequence = GATTGATTTTAATTCTCATTA Gene: VSAK1_10253: Predicted membrane protein	Vibrio splendidus LGP32 Gene: VS_2734: Predicted membrane protein	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_07930: Predicted membrane protein	Photobacterium profundum SS9 Gene: PBPRA0482: Predicted membrane protein	Predicted membrane protein

CRON 30.
VCA0743	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0743: uroporphyrinogen decarboxylase	* Vibrio vulnificus CMCP6 Site: position = -336 score = 5.06362 sequence = TATCAATAATAATTCTCATTC Gene: VV20115: uroporphyrinogen decarboxylase	* Vibrio harveyi ATCC BAA-1116 Site: position = -305 score = 4.42882 sequence = TAATAATTCTCATTTTCAATA Site: position = -311 score = 6.03303 sequence = AATTAATAATAATTCTCATTT Gene: VIBHAR_06129: uroporphyrinogen decarboxylase	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -216 score = 4.44711 sequence = TAATAAGTAAAGTTATCAGTA Gene: VPA0666: uroporphyrinogen decarboxylase	Vibrio shilonii AK1 Gene: VSAK1_15002: uroporphyrinogen decarboxylase	* Vibrio splendidus LGP32 Site: position = -251 score = 4.99031 sequence = ATACAAGAATAATTATCAATT Gene: VS_II0548: uroporphyrinogen decarboxylase	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	uroporphyrinogen decarboxylase

CRON 31.
irgA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -34 score = 6.03303 sequence = AATTAAGAATAATTATCATTT Gene: VC0475: TonB-dependent receptor; Enterobactin receptor IrgA	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -33 score = 6.03029 sequence = AAATAATAATCATTATCAATT Gene: VP2602: TonB-dependent receptor; Enterobactin receptor IrgA	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	TonB-dependent receptor; Enterobactin receptor IrgA

CRON 32.
VV21506	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -79 score = 5.86266 sequence = AATTGATATTCATTCTCATTT Gene: VV21506: hypothetical protein	* Vibrio harveyi ATCC BAA-1116 Site: position = -48 score = 4.89099 sequence = AATTGATATACATTCTCTTTT Gene: VIBHAR_06888: hypothetical protein	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	* Vibrio salmonicida LFI1238 Site: position = -50 score = 5.39348 sequence = AATTGATATAAGTTCTCATTT Gene: VSAL_I0884: hypothetical protein	Vibrio angustum S14	Photobacterium profundum SS9	hypothetical protein

CRON 33.
fbpA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 4 score = 5.17978 sequence = GATTGATAAAGGTTATCATTA Gene: VC0608: Ferric iron ABC transporter, iron-binding protein	2 Vibrio vulnificus CMCP6* Gene: VV1_1661: Ferric iron ABC transporter, iron-binding protein Site: position = -42 score = 5.19986 sequence = TACTGATAAACGTTATCATTA Gene: VV1_1660: Ferric iron ABC transporter, iron-binding protein	* Vibrio harveyi ATCC BAA-1116 Site: position = -41 score = 5.294 sequence = AACTGATAAACGTTATCATTA Gene: VIBHAR_03435: Ferric iron ABC transporter, iron-binding protein	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -40 score = 5.294 sequence = AACTGATAAACGTTATCATTA Gene: VP2491: Ferric iron ABC transporter, iron-binding protein	Vibrio shilonii AK1 Gene: VSAK1_08024: Ferric iron ABC transporter, iron-binding protein	* Vibrio splendidus LGP32 Site: position = -41 score = 5.05958 sequence = AACTGATAGACATTATCATTT Gene: VS_2518: Ferric iron ABC transporter, iron-binding protein	* Vibrio fischeri ES114 Site: position = -53 score = 5.93921 sequence = TATTGATAATTATTATTATTA Site: position = -47 score = 4.88867 sequence = TAATTATTATTATTACCATTT Gene: VF_2151: Ferric iron ABC transporter, iron-binding protein	* Vibrio salmonicida LFI1238 Site: position = -53 score = 5.37443 sequence = TATTGATAAGTATTCTTATTA Gene: VSAL_I2588: Ferric iron ABC transporter, iron-binding protein	* Vibrio angustum S14 Site: position = -46 score = 5.55937 sequence = TATTGAGAAACATTATCATTA Gene: VAS14_20031: Ferric iron ABC transporter, iron-binding protein	* Photobacterium profundum SS9 Site: position = -2 score = 5.51356 sequence = TATTGATAATTGTTATCATTG Gene: PBPRA3184: Ferric iron ABC transporter, iron-binding protein	Ferric iron ABC transporter, iron-binding protein
fbpB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0609: Ferric iron ABC transporter, permease protein	Vibrio vulnificus CMCP6 Gene: VV1_1662: Ferric iron ABC transporter, permease protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_03434: Ferric iron ABC transporter, permease protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2490: Ferric iron ABC transporter, permease protein	Vibrio shilonii AK1 Gene: VSAK1_08029: Ferric iron ABC transporter, permease protein	Vibrio splendidus LGP32 Gene: VS_2517: Ferric iron ABC transporter, permease protein	Vibrio fischeri ES114 Gene: VF_2150: Ferric iron ABC transporter, permease protein	Vibrio salmonicida LFI1238 Gene: VSAL_I2587: Ferric iron ABC transporter, permease protein	Vibrio angustum S14 Gene: VAS14_20036: Ferric iron ABC transporter, permease protein	Photobacterium profundum SS9 Gene: PBPRA3183: Ferric iron ABC transporter, permease protein	Ferric iron ABC transporter, permease protein
fbpC	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0610: Ferric iron ABC transporter, ATP-binding protein	Vibrio vulnificus CMCP6 Gene: VV1_1663: Ferric iron ABC transporter, ATP-binding protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_03433: Ferric iron ABC transporter, ATP-binding protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2489: Ferric iron ABC transporter, ATP-binding protein	Vibrio shilonii AK1 Gene: VSAK1_08034: Ferric iron ABC transporter, ATP-binding protein	Vibrio splendidus LGP32 Gene: VS_2516: Ferric iron ABC transporter, ATP-binding protein	Vibrio fischeri ES114 Gene: VF_2149: Ferric iron ABC transporter, ATP-binding protein	Vibrio salmonicida LFI1238 Gene: VSAL_I2586: Ferric iron ABC transporter, ATP-binding protein	Vibrio angustum S14 Gene: VAS14_20041: Ferric iron ABC transporter, ATP-binding protein	Photobacterium profundum SS9 Gene: PBPRA3182: Ferric iron ABC transporter, ATP-binding protein	Ferric iron ABC transporter, ATP-binding protein

CRON 34.
VV20793	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -95 score = 4.80205 sequence = AAATGATATAAACTTGCATTT Site: position = -78 score = 5.53046 sequence = ATTTGATAATAATTTTCATTT Gene: VV20793: Conserved hypothetical protein	* Vibrio harveyi ATCC BAA-1116 Site: position = -50 score = 5.81474 sequence = AATTGATAATTAATTTCATTT Site: position = -73 score = 4.76887 sequence = AAATGAAAACAAGTCGCACTT Gene: VIBHAR_05095: Conserved hypothetical protein	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -57 score = 5.71754 sequence = AATTGATAATCAATTTCATTT Site: position = -80 score = 4.81677 sequence = AAATGAAAACAATACGCACTT Gene: VPA1494: Conserved hypothetical protein	2 Vibrio shilonii AK1* Site: position = -40 score = 5.54582 sequence = AAATGATATTTATTTGCAATT Site: position = -23 score = 4.63802 sequence = AATTGATTCTAATTTGCATTT Gene: VSAK1_06125: Conserved hypothetical protein Site: position = -73 score = 5.06605 sequence = AAATGATAATTACTTGCATTC Gene: VSAK1_17632: Conserved hypothetical protein	* Vibrio splendidus LGP32 Site: position = -72 score = 4.60032 sequence = GAATGATTTTAATTTGCAATT Site: position = -55 score = 5.96017 sequence = AATTGATAATAAATATCATTA Site: position = -49 score = 4.68025 sequence = TAATAAATATCATTAACATTT Gene: VS_II1376: Conserved hypothetical protein	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -54 score = 5.86297 sequence = AATTGATAATGAATATCATTA Gene: PBPRB1172: Conserved hypothetical protein	Conserved hypothetical protein
VV20794	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV20794: ABC transporter, ATP-binding protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05094: ABC transporter, ATP-binding protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1495: ABC transporter, ATP-binding protein	Vibrio shilonii AK1 Gene: VSAK1_17627: ABC transporter, ATP-binding protein	Vibrio splendidus LGP32 Gene: VS_II1377: ABC transporter, ATP-binding protein	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1173: ABC transporter, ATP-binding protein	ABC transporter, ATP-binding protein

CRON 35.
VCA1041	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -61 score = 5.16447 sequence = TTTTGAGAATAAATATCAATT Gene: VCA1041: Phosphomannomutase	* Vibrio vulnificus CMCP6 Site: position = -57 score = 6.20547 sequence = AAATGATATTTATTATCATTT Gene: VV20569: Phosphomannomutase	* Vibrio harveyi ATCC BAA-1116 Site: position = -93 score = 4.57184 sequence = AATTGAGAACCATTTACATTG Gene: VIBHAR_06273: Phosphomannomutase	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -99 score = 5.00459 sequence = AATTGAGAACCATTTACATTA Gene: VPA0535: Phosphomannomutase	* Vibrio shilonii AK1 Site: position = -98 score = 4.35644 sequence = TAATGATATTGAGAGTCATTT Gene: VSAK1_17622: Phosphomannomutase	* Vibrio splendidus LGP32 Site: position = -63 score = 5.76333 sequence = AAATGATAATCAGTATCATTT Gene: VS_II0364: Phosphomannomutase	* Vibrio fischeri ES114 Site: position = -59 score = 5.84211 sequence = AATTGATAATGTTTATCATTT Gene: VF_1056: Phosphomannomutase	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -123 score = 5.53576 sequence = TAATGCGAATGTTTATCATTT Gene: VAS14_13784: Phosphomannomutase	* Photobacterium profundum SS9 Site: position = -63 score = 5.65077 sequence = TAATGCGAATGAATATCATTT Gene: PBPRB0614: Phosphomannomutase	Phosphomannomutase

CRON 36.
PF11449	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 1 score = 4.86436 sequence = TGTCGATAATAATTCTCATTC Site: position = -24 score = 5.1337 sequence = AATTGCGAATAGTTCTCAACT Gene: VC1688: Predicted manganese transporter, 11 TMS	* Vibrio vulnificus CMCP6 Site: position = -62 score = 5.46499 sequence = TATTGCGAATAATTCTCACTT Site: position = -36 score = 5.99285 sequence = TAATGATAATCATTCTTATTT Gene: VV1_2889: Predicted manganese transporter, 11 TMS	* Vibrio harveyi ATCC BAA-1116 Site: position = -36 score = 5.91653 sequence = TAATGAGAATTATTACCATTT Site: position = -62 score = 5.46499 sequence = TATTGCGAATAATTCTCACTT Gene: VIBHAR_01859: Predicted manganese transporter, 11 TMS	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -30 score = 4.4636 sequence = TAATTATTACCATTTGCATTT Site: position = -62 score = 5.50235 sequence = TATTGCGAATAAATCTCATTT Site: position = -36 score = 6.01099 sequence = TAATGATAATTATTACCATTT Gene: VP1164: Predicted manganese transporter, 11 TMS	* Vibrio shilonii AK1 Site: position = -63 score = 5.05425 sequence = CATTGAGAATTATTCTCATAT Site: position = -37 score = 6.28269 sequence = TAATGATAATAATTCTCATTT Gene: VSAK1_04382: Predicted manganese transporter, 11 TMS	* Vibrio splendidus LGP32 Site: position = -61 score = 5.93749 sequence = AATTGATAATTATTATCATTC Site: position = -67 score = 4.3675 sequence = GAATGCAATTGATAATTATTA Gene: VS_2002: Predicted manganese transporter, 11 TMS	* Vibrio fischeri ES114 Site: position = -39 score = 5.30436 sequence = TACTAATAATCATTCGCATTT Site: position = -65 score = 5.83377 sequence = AGTTGATAATAATTCTCATTT Site: position = -72 score = 4.55738 sequence = AAATGATAGTTGATAATAATT Gene: VF_A0848: Predicted manganese transporter, 11 TMS	* Vibrio salmonicida LFI1238 Site: position = -39 score = 5.30436 sequence = TACTAATAATCATTCGCATTT Site: position = -72 score = 4.55738 sequence = AAATGATAGTTGATAATAATT Site: position = -65 score = 5.83377 sequence = AGTTGATAATAATTCTCATTT Gene: VSAL_II0074: Predicted manganese transporter, 11 TMS	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -77 score = 5.74255 sequence = ACTTGATAATAATTCTCATTT Site: position = -71 score = 4.4052 sequence = TAATAATTCTCATTTGCATTT Gene: PBPRB2013: Predicted manganese transporter, 11 TMS	Predicted manganese transporter, 11 TMS

CRON 37.
VSAK1_03314	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -102 score = 5.77725 sequence = AAATGATAATAGTTTGCATTT Gene: VSAK1_03314: putative transcriptional regulator, AraC/XylS family protein	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	putative transcriptional regulator, AraC/XylS family protein

CRON 38.
pVSAL320_27	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	* Vibrio salmonicida LFI1238 Site: position = -66 score = 5.72704 sequence = AAATGAGATTCATTATTATTA Gene: pVSAL320_27: putative periplasmic iron siderophore binding protein of ABC transporter	Vibrio angustum S14	Photobacterium profundum SS9	putative periplasmic iron siderophore binding protein of ABC transporter
pVSAL320_28	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: pVSAL320_28: transport system permease protein	Vibrio angustum S14	Photobacterium profundum SS9	transport system permease protein
pVSAL320_29	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: pVSAL320_29: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)	Vibrio angustum S14	Photobacterium profundum SS9	Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
pVSAL320_30	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238 Gene: pVSAL320_30: hypothetical protein	Vibrio angustum S14	Photobacterium profundum SS9	hypothetical protein

CRON 39.
VC0773	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -114 score = 4.6574 sequence = AAATGGAAATTGCTTGCATTT Site: position = -91 score = 5.66493 sequence = TAATAAAAACTATTCTCATTT Gene: VC0773: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific	* Vibrio vulnificus CMCP6 Site: position = -264 score = 4.70318 sequence = TAATTATTATCGTTAGCATTT Site: position = -270 score = 5.79037 sequence = TAATGATAATTATTATCGTTA Gene: VV20835: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific	* Vibrio harveyi ATCC BAA-1116 Site: position = -50 score = 5.2635 sequence = AAATGAGAAGGGATCTCATTT Site: position = -113 score = 4.99009 sequence = GAGTGATAATTATTATCAAAA Site: position = -119 score = 4.55283 sequence = TAATGCGAGTGATAATTATTA Gene: VIBHAR_01398: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1824: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific	Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific
VC0772	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0772: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE	Vibrio vulnificus CMCP6 Gene: VV20836: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01399: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1823: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE	2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE

CRON 40.
mntH	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = -66 score = 5.31875 sequence = AGGTGATATTGATTCTCATTT Gene: VIBHAR_04897: Manganese transport protein MntH	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -67 score = 5.35301 sequence = AGATGCGATTGATTATCATTT Gene: VSAK1_15507: Manganese transport protein MntH	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -61 score = 5.6242 sequence = AAATGACATTGATTATCATTT Gene: VAS14_12039: Manganese transport protein MntH	Photobacterium profundum SS9	Manganese transport protein MntH

CRON 41.
hutA	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -84 score = 5.54251 sequence = AAATAATAATACATATCATTT Gene: VSAK1_23799: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor	Vibrio splendidus LGP32 Gene: VS_II0751: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor	* Vibrio fischeri ES114 Site: position = -69 score = 4.41997 sequence = TAGTAATTATCATTCGTAATA Site: position = -81 score = 4.43399 sequence = AAATGAAAATGATAGTAATTA Site: position = -75 score = 5.57453 sequence = AAATGATAGTAATTATCATTC Gene: VF_1234: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -79 score = 5.27595 sequence = TAACGATAGTAATTCTCATTT Gene: PBPRA1535: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor	TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor

CRON 42.
VV21010	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -75 score = 5.06739 sequence = AAATGAGAATCAATTGTAATA Gene: VV21010: Hypothetical protein in aerobactin uptake cluster	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Hypothetical protein in aerobactin uptake cluster
fhuC	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -81 score = 4.7806 sequence = TTATGAAAACAATTCTCATTG Gene: VV21011: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1 Gene: VSAK1_20939: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component	* Vibrio splendidus LGP32 Site: position = -73 score = 4.39733 sequence = GAATAATTATCATTTTGATTT Site: position = -79 score = 4.72169 sequence = TTTAGCGAATAATTATCATTT Gene: VS_2112: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component	* Vibrio fischeri ES114 Site: position = -31 score = 5.56229 sequence = GAATAAAAATAATTATCATTA Site: position = -25 score = 5.01397 sequence = AAATAATTATCATTAACATTT Gene: VF_A0158: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component	* Vibrio salmonicida LFI1238 Site: position = -75 score = 4.56715 sequence = AAACAATTATCATTACTATTT Site: position = -81 score = 5.37674 sequence = GAATAAAAACAATTATCATTA Gene: VSAL_II0150: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component	Vibrio angustum S14	Photobacterium profundum SS9	ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
fhuD	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV21012: ABC-type Fe3+-hydroxamate transport system, periplasmic component	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1 Gene: VSAK1_20944: ABC-type Fe3+-hydroxamate transport system, periplasmic component	Vibrio splendidus LGP32 Gene: VS_2113: ABC-type Fe3+-hydroxamate transport system, periplasmic component	Vibrio fischeri ES114 Gene: VF_A0159: ABC-type Fe3+-hydroxamate transport system, periplasmic component	Vibrio salmonicida LFI1238 Gene: VSAL_II0151: ABC-type Fe3+-hydroxamate transport system, periplasmic component	Vibrio angustum S14	Photobacterium profundum SS9	ABC-type Fe3+-hydroxamate transport system, periplasmic component
fhuB	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV21013: ABC-type Fe3+-siderophore transport system, permease component	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1 Gene: VSAK1_20949: ABC-type Fe3+-siderophore transport system, permease component	Vibrio splendidus LGP32 Gene: VS_2114: ABC-type Fe3+-siderophore transport system, permease component	Vibrio fischeri ES114 Gene: VF_A0160: ABC-type Fe3+-siderophore transport system, permease component	Vibrio salmonicida LFI1238 Gene: VSAL_II0152: ABC-type Fe3+-siderophore transport system, permease component	Vibrio angustum S14	Photobacterium profundum SS9	ABC-type Fe3+-siderophore transport system, permease component

CRON 43.
bfd	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -54 score = 4.88758 sequence = AAATAAGAGTGATTCTCTTTT Gene: VC0364: Bacterioferritin-associated ferredoxin	* Vibrio vulnificus CMCP6 Site: position = -57 score = 5.53794 sequence = TAATGATAATGATTATCTATT Gene: VV1_1340: Bacterioferritin-associated ferredoxin	* Vibrio harveyi ATCC BAA-1116 Site: position = -58 score = 4.53494 sequence = TAACAAGAACGATTCTTGTTT Gene: VIBHAR_00053: Bacterioferritin-associated ferredoxin	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -59 score = 4.36142 sequence = TAACAAGAACCATTCCCGTTT Gene: VP2769: Bacterioferritin-associated ferredoxin	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -59 score = 5.09296 sequence = AAATGCAAACGATTCTCGTTT Gene: PBPRA0317: Bacterioferritin-associated ferredoxin	Bacterioferritin-associated ferredoxin
bfr	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0365: Bacterioferritin	Vibrio vulnificus CMCP6 Gene: VV1_1341: Bacterioferritin	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_00052: Bacterioferritin	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2768: Bacterioferritin	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRA0318: Bacterioferritin	Bacterioferritin

CRON 44.
torS	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -41 score = 5.35212 sequence = TAACGATAATTATTCTTAATA Gene: VCA0068: Methyl-accepting chemotaxis protein	* Vibrio vulnificus CMCP6 Site: position = -49 score = 5.20015 sequence = CAATAATATTCATTCTCATTA Gene: VV21555: Methyl-accepting chemotaxis protein	* Vibrio harveyi ATCC BAA-1116 Site: position = -2 score = 5.33438 sequence = AAATGATAATAGTTATAATCT Gene: VIBHAR_05136: Methyl-accepting chemotaxis protein	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -40 score = 4.47896 sequence = TAATAATAATGATAATAATCA Gene: VPA1462: Methyl-accepting chemotaxis protein	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II0204: Methyl-accepting chemotaxis protein	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Methyl-accepting chemotaxis protein

CRON 45.
PBPRB1816	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -121 score = 5.31972 sequence = GATTGATAACTATTTTTATTT Gene: PBPRB1816: Ferrichrome transport system permease protein FhuB (TC 3.A.1.14.3)	Ferrichrome transport system permease protein FhuB (TC 3.A.1.14.3)
PBPRB1815	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1815: ABC-type Fe3+-siderophore transport system, permease component	ABC-type Fe3+-siderophore transport system, permease component
VIBHAR_01766	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01766: Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3)	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1814: Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3)	Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3)
VIBHAR_01763	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = -29 score = 5.18994 sequence = AAATATCAATAATTATCATTT Gene: VIBHAR_01763: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
VIBHAR_01767	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01767: hypothetical protein	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0488: hypothetical protein	* Vibrio salmonicida LFI1238 Site: position = -30 score = 4.9911 sequence = AAATAAGAATAATTACTAAGT Gene: VSAL_II0573: hypothetical protein	Vibrio angustum S14	Photobacterium profundum SS9	hypothetical protein

CRON 46.
VC1572	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -40 score = 5.61803 sequence = ATGTGATAATAATTATCATTT Gene: VC1572: hypothetical protein	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = -41 score = 6.13185 sequence = TATTGATAATAATTATCATTA Site: position = -38 score = 4.5203 sequence = TGATAATAATTATCATTATCT Gene: VIBHAR_00162: hypothetical protein	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -41 score = 6.22599 sequence = AATTGATAATAATTATCATTA Site: position = -38 score = 4.5203 sequence = TGATAATAATTATCATTATCT Gene: VP2872: hypothetical protein	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -45 score = 5.6759 sequence = ATTTGATAATAATTATCATTA Site: position = -39 score = 4.53719 sequence = TAATAATTATCATTAACATTC Gene: VS_2936: hypothetical protein	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -98 score = 5.56567 sequence = AGATGATAATAATTATCAGTA Site: position = -92 score = 4.49362 sequence = TAATAATTATCAGTAGCAATT Site: position = -44 score = 5.60191 sequence = CAATGATAATGATTATCAATA Gene: VAS14_13589: hypothetical protein	Photobacterium profundum SS9	hypothetical protein
fumC	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1573: Fumarate hydratase class II (EC 4.2.1.2)	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_00163: Fumarate hydratase class II (EC 4.2.1.2)	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2873: Fumarate hydratase class II (EC 4.2.1.2)	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_2937: Fumarate hydratase class II (EC 4.2.1.2)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_13594: Fumarate hydratase class II (EC 4.2.1.2)	Photobacterium profundum SS9 Gene: PBPRB0402: Fumarate hydratase class II (EC 4.2.1.2)	Fumarate hydratase class II (EC 4.2.1.2)

CRON 47.
VV1_2646	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -23 score = 5.01868 sequence = AAATAGGACTTATTCTCATTA Gene: VV1_2646: ABC-type multidrug transport system, ATPase and permease component	* Vibrio harveyi ATCC BAA-1116 Site: position = -24 score = 4.86752 sequence = TAATAGGACTTATTCTCAATT Gene: VIBHAR_02349: ABC-type multidrug transport system, ATPase and permease component	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -24 score = 4.96165 sequence = AAATAGGACTTATTCTCAATT Gene: VP1609: ABC-type multidrug transport system, ATPase and permease component	* Vibrio shilonii AK1 Site: position = -23 score = 4.6485 sequence = TAATAGGAACTATTCTCAAAA Gene: VSAK1_05315: ABC-type multidrug transport system, ATPase and permease component	* Vibrio splendidus LGP32 Site: position = -23 score = 5.01868 sequence = AAATAGGACTTATTCTCATTA Gene: VS_1414: ABC-type multidrug transport system, ATPase and permease component	* Vibrio fischeri ES114 Site: position = -26 score = 4.43344 sequence = AGATAATAATAGGAATCATTA Site: position = -20 score = 5.22938 sequence = TAATAGGAATCATTATCACTA Gene: VF_1277: ABC-type multidrug transport system, ATPase and permease component	* Vibrio salmonicida LFI1238 Site: position = -20 score = 5.00535 sequence = TAATAGGAATCATTCTCATTG Gene: VSAL_I1541: ABC-type multidrug transport system, ATPase and permease component	* Vibrio angustum S14 Site: position = -60 score = 4.72592 sequence = AAATGAAAACACTTAACAATA Site: position = -41 score = 4.79663 sequence = TAATAGGAATCATTATCACTG Gene: VAS14_02953: ABC-type multidrug transport system, ATPase and permease component	Photobacterium profundum SS9 Gene: PBPRA1924: ABC-type multidrug transport system, ATPase and permease component	ABC-type multidrug transport system, ATPase and permease component
pqiA	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1500: Paraquat-inducible protein A	Vibrio vulnificus CMCP6 Gene: VV1_2647: Paraquat-inducible protein A	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02350: Paraquat-inducible protein A	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1610: Paraquat-inducible protein A	Vibrio shilonii AK1 Gene: VSAK1_05320: Paraquat-inducible protein A	Vibrio splendidus LGP32 Gene: VS_1413: Paraquat-inducible protein A	Vibrio fischeri ES114 Gene: VF_1276: Paraquat-inducible protein A	Vibrio salmonicida LFI1238 Gene: VSAL_I1540: Paraquat-inducible protein A	Vibrio angustum S14 Gene: VAS14_02958: Paraquat-inducible protein A	Photobacterium profundum SS9 Gene: PBPRA1925: Paraquat-inducible protein A	Paraquat-inducible protein A
pqiB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1501: Paraquat-inducible protein B	Vibrio vulnificus CMCP6 Gene: VV1_2648: Paraquat-inducible protein B	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02351: Paraquat-inducible protein B	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1611: Paraquat-inducible protein B	Vibrio shilonii AK1 Gene: VSAK1_05325: Paraquat-inducible protein B	Vibrio splendidus LGP32 Gene: VS_1412: Paraquat-inducible protein B	Vibrio fischeri ES114 Gene: VF_1275: Paraquat-inducible protein B	Vibrio salmonicida LFI1238 Gene: VSAL_I1539: Paraquat-inducible protein B	Vibrio angustum S14 Gene: VAS14_02963: Paraquat-inducible protein B	Photobacterium profundum SS9 Gene: PBPRA1926: Paraquat-inducible protein B	Paraquat-inducible protein B

CRON 48.
frdA	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC2656: fumarate reductase, flavoprotein subunit	Vibrio vulnificus CMCP6 Gene: VV1_1269: fumarate reductase, flavoprotein subunit	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_00131: fumarate reductase, flavoprotein subunit	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2840: fumarate reductase, flavoprotein subunit	* Vibrio shilonii AK1 Site: position = -256 score = 4.85498 sequence = AAATCATAATTAAACTCATTA Gene: VSAK1_11298: fumarate reductase, flavoprotein subunit	Vibrio splendidus LGP32 Gene: VS_0248: fumarate reductase, flavoprotein subunit	* Vibrio fischeri ES114 Site: position = -298 score = 5.25694 sequence = CAATAAGAATCATTATCACTT Gene: VF_2334: fumarate reductase, flavoprotein subunit	* Vibrio salmonicida LFI1238 Site: position = -256 score = 4.86504 sequence = CGATAAGAATCATTATCACTT Gene: VSAL_I2788: fumarate reductase, flavoprotein subunit	Vibrio angustum S14 Gene: VAS14_18896: fumarate reductase, flavoprotein subunit	Photobacterium profundum SS9 Gene: PBPRA3378: fumarate reductase, flavoprotein subunit	fumarate reductase, flavoprotein subunit
frdB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC2657: fumarate reductase, iron-sulfur protein	Vibrio vulnificus CMCP6 Gene: VV1_1268: fumarate reductase, iron-sulfur protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_00132: fumarate reductase, iron-sulfur protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2841: fumarate reductase, iron-sulfur protein	Vibrio shilonii AK1 Gene: VSAK1_11293: fumarate reductase, iron-sulfur protein	Vibrio splendidus LGP32 Gene: VS_0247: fumarate reductase, iron-sulfur protein	Vibrio fischeri ES114 Gene: VF_2335: fumarate reductase, iron-sulfur protein	Vibrio salmonicida LFI1238 Gene: VSAL_I2789: fumarate reductase, iron-sulfur protein	Vibrio angustum S14 Gene: VAS14_18901: fumarate reductase, iron-sulfur protein	Photobacterium profundum SS9 Gene: PBPRA3379: fumarate reductase, iron-sulfur protein	fumarate reductase, iron-sulfur protein
frdC	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC2658: fumarate reductase, 15 kDa hydrophobic protein	Vibrio vulnificus CMCP6 Gene: VV1_1267: fumarate reductase, 15 kDa hydrophobic protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_00133: fumarate reductase, 15 kDa hydrophobic protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2842: fumarate reductase, 15 kDa hydrophobic protein	Vibrio shilonii AK1 Gene: VSAK1_11288: fumarate reductase, 15 kDa hydrophobic protein	Vibrio splendidus LGP32 Gene: VS_0246: fumarate reductase, 15 kDa hydrophobic protein	Vibrio fischeri ES114 Gene: VF_2336: fumarate reductase, 15 kDa hydrophobic protein	Vibrio salmonicida LFI1238 Gene: VSAL_I2790: fumarate reductase, 15 kDa hydrophobic protein	Vibrio angustum S14 Gene: VAS14_18906: fumarate reductase, 15 kDa hydrophobic protein	Photobacterium profundum SS9 Gene: PBPRA3380: fumarate reductase, 15 kDa hydrophobic protein	fumarate reductase, 15 kDa hydrophobic protein
frdD	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC2659: fumarate reductase, 13 kDa hydrophobic protein	Vibrio vulnificus CMCP6 Gene: VV1_1266: fumarate reductase, 13 kDa hydrophobic protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_00134: fumarate reductase, 13 kDa hydrophobic protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VP2843: fumarate reductase, 13 kDa hydrophobic protein	Vibrio shilonii AK1 Gene: VSAK1_11283: fumarate reductase, 13 kDa hydrophobic protein	Vibrio splendidus LGP32 Gene: VS_0245: fumarate reductase, 13 kDa hydrophobic protein	Vibrio fischeri ES114 Gene: VF_2337: fumarate reductase, 13 kDa hydrophobic protein	Vibrio salmonicida LFI1238 Gene: VSAL_I2791: fumarate reductase, 13 kDa hydrophobic protein	Vibrio angustum S14 Gene: VAS14_18911: fumarate reductase, 13 kDa hydrophobic protein	Photobacterium profundum SS9 Gene: PBPRA3381: fumarate reductase, 13 kDa hydrophobic protein	fumarate reductase, 13 kDa hydrophobic protein

CRON 49.
azu1	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -27 score = 5.30742 sequence = TGTTGAAAATAATTCTTATTT Gene: VS_II0661: Pseudoazurin (blue copper protein)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Pseudoazurin (blue copper protein)

CRON 50.
VPA1658	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -208 score = 5.54018 sequence = AAATAAGAACAAATATTATTT Gene: VPA1658: Vibrioferrin ligase/carboxylase protein PvsA	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -211 score = 5.35018 sequence = GAATAAGAACAAATATCATTT Gene: VS_II1129: Vibrioferrin ligase/carboxylase protein PvsA	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Vibrioferrin ligase/carboxylase protein PvsA
VPA1659	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1659: Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1130: Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B
VPA1660	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1660: Vibrioferrin membrane-spanning transport protein PvsC	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1131: Vibrioferrin membrane-spanning transport protein PvsC	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Vibrioferrin membrane-spanning transport protein PvsC
VPA1661	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1661: Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1132: Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A
VPA1662	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1662: Vibrioferrin decarboxylase protein PvsE	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1133: Vibrioferrin decarboxylase protein PvsE	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Vibrioferrin decarboxylase protein PvsE

CRON 51.
VC0074	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -29 score = 4.46852 sequence = GTCTGAGAATAATTCGTATTT Gene: VC0074: conserved hypothetical protein	* Vibrio vulnificus CMCP6 Site: position = -66 score = 5.18933 sequence = AACTAAGAATTATTATTATTC Gene: VV1_1113: conserved hypothetical protein	* Vibrio harveyi ATCC BAA-1116 Site: position = -78 score = 5.47783 sequence = AACTAAGAATTATTATTATTA Gene: VIBHAR_00530: conserved hypothetical protein	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -66 score = 5.57197 sequence = AACTAAGAATTATTATTATTT Gene: VP0074: conserved hypothetical protein	* Vibrio shilonii AK1 Site: position = -47 score = 4.52152 sequence = AACTAAGAATCATTCCTGTTT Gene: VSAK1_12905: conserved hypothetical protein	* Vibrio splendidus LGP32 Site: position = -38 score = 5.09213 sequence = AACTAAGAATCATTATTATTC Gene: VS_0088: conserved hypothetical protein	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -62 score = 5.17428 sequence = AATTACGAATCATTATCGTTT Gene: VAS14_22809: conserved hypothetical protein	* Photobacterium profundum SS9 Site: position = -19 score = 5.19297 sequence = AACTGATAATGATTAGCGTTT Gene: PBPRA3532: conserved hypothetical protein	conserved hypothetical protein

CRON 52.
VSAK1_26775	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -52 score = 5.4723 sequence = AAATGAAAGTAATTATCAATA Site: position = -46 score = 4.44498 sequence = AAGTAATTATCAATAACATTT Gene: VSAK1_26775: ferrichrome-iron receptor	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	ferrichrome-iron receptor
VSAK1_26770	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1 Gene: VSAK1_26770: ferrichrome-iron receptor	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	ferrichrome-iron receptor
VSAK1_26765	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1 Gene: VSAK1_26765: hypothetical protein	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	hypothetical protein

CRON 53.
VC0774	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -97 score = 5.66493 sequence = AAATGAGAATAGTTTTTATTA Site: position = -74 score = 4.6574 sequence = AAATGCAAGCAATTTCCATTT Gene: VC0774: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA	* Vibrio vulnificus CMCP6 Site: position = -122 score = 5.79037 sequence = TAACGATAATAATTATCATTA Site: position = -128 score = 4.70318 sequence = AAATGCTAACGATAATAATTA Gene: VV20834: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_01396: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1820: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA

CRON 54.
viuA	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -290 score = 4.96512 sequence = AAATGAGAATGCTTTACATTT Gene: VC2211: Ferric aerobactin receptor, TonB-dependent	* Vibrio vulnificus CMCP6 Site: position = -299 score = 4.96512 sequence = AAATGAGAATGCTTTACATTT Gene: VV20843: Ferric aerobactin receptor, TonB-dependent	* Vibrio harveyi ATCC BAA-1116 Site: position = -134 score = 5.18994 sequence = AAATGATAATTATTGATATTT Gene: VIBHAR_01762: Ferric aerobactin receptor, TonB-dependent	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1121: Ferric aerobactin receptor, TonB-dependent	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Ferric aerobactin receptor, TonB-dependent

CRON 55.
VSAK1_18187	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -64 score = 5.61338 sequence = TAATGACAATAGTTATCATTA Gene: VSAK1_18187: TonB-dependent receptor	* Vibrio splendidus LGP32 Site: position = -46 score = 5.49178 sequence = TAATGCAAACCATTATCATTA Site: position = -17 score = 4.88516 sequence = ATATAAGAATAAATATCATGT Gene: VS_1633: TonB-dependent receptor	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	TonB-dependent receptor

CRON 56.
fecB	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -69 score = 5.31972 sequence = AAATAAAAATAGTTATCAATC Gene: PBPRB1817: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)	Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)

CRON 57.
VIBHAR_06301	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = -2 score = 4.93973 sequence = AAATGAGAATTAGTTTCGTTA Gene: VIBHAR_06301: hypothetical protein	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	hypothetical protein
VV21338	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -154 score = 5.50324 sequence = AAATGATAACCATTCTCTTTT Gene: VV21338: HTH-type transcription regulator, AraC-family	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06300: HTH-type transcription regulator, AraC-family	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1 Gene: VSAK1_26780: HTH-type transcription regulator, AraC-family	* Vibrio splendidus LGP32 Site: position = -244 score = 4.57362 sequence = AAATGAGAATCAGTTGCGTTA Gene: VS_II0500: HTH-type transcription regulator, AraC-family	Vibrio fischeri ES114 Gene: VF_A0785: HTH-type transcription regulator, AraC-family	Vibrio salmonicida LFI1238 Gene: VSAL_II0910: HTH-type transcription regulator, AraC-family	Vibrio angustum S14	Photobacterium profundum SS9	HTH-type transcription regulator, AraC-family

CRON 58.
vibH	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -214 score = 4.79459 sequence = AAATAAAAATGTTTTTCATTG Site: position = -196 score = 4.87378 sequence = TTGTAATATTGATTCTCATTT Gene: VC0775: Amide synthase component of siderophore synthetase # Vibriobactin-specific, VibH	* Vibrio vulnificus CMCP6 Site: position = -79 score = 5.6077 sequence = AATTGATAACTATTATCATTG Gene: VV20844: Amide synthase component of siderophore synthetase # Vibriobactin-specific, VibH	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Amide synthase component of siderophore synthetase # Vibriobactin-specific, VibH

CRON 59.
VCA0576	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -60 score = 5.67749 sequence = AAATGATAGCAATTATCATTA Gene: VCA0576: TonB-dependent heme and hemoglobin receptor HutA; TonB-dependent hemin , ferrichrome receptor	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	TonB-dependent heme and hemoglobin receptor HutA; TonB-dependent hemin , ferrichrome receptor

CRON 60.
VPA1434	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -109 score = 5.45153 sequence = TAATTGTAATTATTATCATTT Gene: VPA1434: putative hemolysin secretion ATP-binding protein	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -160 score = 5.40397 sequence = TAATGATAATGATTGTCATCT Gene: PBPRA1567: putative hemolysin secretion ATP-binding protein	putative hemolysin secretion ATP-binding protein

CRON 61.
VSAK1_16967	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	* Vibrio shilonii AK1 Site: position = -42 score = 4.82343 sequence = TATTAATAATAAAACTTATTA Gene: VSAK1_16967: outer membrane protein OmpU	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -74 score = 5.34295 sequence = TAATGATTACCATTCTCATTA Gene: VAS14_08970: outer membrane protein OmpU	Photobacterium profundum SS9	outer membrane protein OmpU

CRON 62.
ppaC	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -143 score = 5.1337 sequence = AGTTGAGAACTATTCGCAATT Gene: VC1687: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	* Vibrio vulnificus CMCP6 Site: position = -163 score = 5.99285 sequence = AAATAAGAATGATTATCATTA Site: position = -137 score = 5.46499 sequence = AAGTGAGAATTATTCGCAATA Gene: VV1_2888: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	* Vibrio harveyi ATCC BAA-1116 Site: position = -191 score = 5.91653 sequence = AAATGGTAATAATTCTCATTA Site: position = -165 score = 5.46499 sequence = AAGTGAGAATTATTCGCAATA Gene: VIBHAR_01860: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	2 Vibrio parahaemolyticus RIMD 2210633* Site: position = -185 score = 4.4636 sequence = AAATGCAAATGGTAATAATTA Site: position = -179 score = 6.01099 sequence = AAATGGTAATAATTATCATTA Site: position = -153 score = 5.50235 sequence = AAATGAGATTTATTCGCAATA Gene: VP1165: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) Gene: VP1770: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	* Vibrio shilonii AK1 Site: position = -192 score = 6.28269 sequence = AAATGAGAATTATTATCATTA Site: position = -166 score = 5.05425 sequence = ATATGAGAATAATTCTCAATG Gene: VSAK1_04387: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	* Vibrio splendidus LGP32 Site: position = -161 score = 5.93749 sequence = GAATGATAATAATTATCAATT Site: position = -155 score = 4.3675 sequence = TAATAATTATCAATTGCATTC Gene: VS_2001: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	Vibrio fischeri ES114 Gene: VF_A0421: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	Vibrio salmonicida LFI1238 Gene: VSAL_II0738: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	Vibrio angustum S14 Gene: VAS14_03748: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	2 Photobacterium profundum SS9 Gene: PBPRB1355: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) Gene: PBPRA1513: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)	Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)

CRON 63.
VAS14_13349	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -116 score = 4.56304 sequence = ATATAGTAATAAGTCTCATTA Site: position = -53 score = 5.79037 sequence = TAACGATAATTATTATCATTA Site: position = -47 score = 4.965 sequence = TAATTATTATCATTATTATTT Gene: VAS14_13349: Periplasmic binding protein	Photobacterium profundum SS9	Periplasmic binding protein
fecD	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_13354: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)	Photobacterium profundum SS9 Gene: PBPRB1385: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)	Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
fecE	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_13359: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)	Photobacterium profundum SS9 Gene: PBPRB1384: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)	Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)

CRON 64.
iscA	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -102 score = 4.50736 sequence = ATATGCAAATGATAATCAATA Site: position = -96 score = 5.71637 sequence = AAATGATAATCAATATCATCT Site: position = -207 score = 5.84201 sequence = TAATGATAATCATTATTAATA Gene: VS_1901: Iron binding protein IscA for iron-sulfur cluster assembly	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Iron binding protein IscA for iron-sulfur cluster assembly
sufB	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1902: Iron-sulfur cluster assembly protein SufB	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Iron-sulfur cluster assembly protein SufB
sufC	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1903: Iron-sulfur cluster assembly ATPase protein SufC	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Iron-sulfur cluster assembly ATPase protein SufC
sufD	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1904: Iron-sulfur cluster assembly protein SufD	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Iron-sulfur cluster assembly protein SufD
sufS	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1905: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufE	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_1906: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Sulfur acceptor protein SufE for iron-sulfur cluster assembly

CRON 65.
VV21178	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -41 score = 6.37715 sequence = AAATGATAATAATTATCATTA Site: position = -38 score = 4.36211 sequence = TGATAATAATTATCATTATAT Gene: VV21178: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component	* Vibrio harveyi ATCC BAA-1116 Site: position = -46 score = 5.02391 sequence = TAATGATAATGATAATGATTA Site: position = -40 score = 5.6891 sequence = TAATGATAATGATTATCTTTT Gene: VIBHAR_07043: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -2 score = 5.7863 sequence = TAATGATAATAATTATCTTTT Gene: VPA0004: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -31 score = 5.9463 sequence = TAATGATAATAGTTATCAATA Gene: VS_II1528: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component	* Vibrio fischeri ES114 Site: position = -44 score = 5.03841 sequence = TGATAATAATGATAATCATTA Site: position = -38 score = 5.30646 sequence = TAATGATAATCATTATCTTTC Gene: VF_A0200: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -53 score = 5.43268 sequence = TAATGATAATAAGTTTCATTA Site: position = -47 score = 4.68106 sequence = TAATAAGTTTCATTATCATGT Gene: VAS14_10859: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component	Photobacterium profundum SS9	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
VV21177	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV21177: ABC-type oligopeptide transport system, ATPase component	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0003: ABC-type oligopeptide transport system, ATPase component	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1529: ABC-type oligopeptide transport system, ATPase component	Vibrio fischeri ES114 Gene: VF_A0199: ABC-type oligopeptide transport system, ATPase component	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_10854: ABC-type oligopeptide transport system, ATPase component	Photobacterium profundum SS9	ABC-type oligopeptide transport system, ATPase component
VCA0003	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0003: Conesrved hypothetical protein	Vibrio vulnificus CMCP6 Gene: VV21176: Conesrved hypothetical protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_07045: Conesrved hypothetical protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0002: Conesrved hypothetical protein	Vibrio shilonii AK1	Vibrio splendidus LGP32 Gene: VS_II1530: Conesrved hypothetical protein	Vibrio fischeri ES114 Gene: VF_A0198: Conesrved hypothetical protein	Vibrio salmonicida LFI1238 Gene: VSAL_II0169: Conesrved hypothetical protein	Vibrio angustum S14 Gene: VAS14_10849: Conesrved hypothetical protein	Photobacterium profundum SS9 Gene: PBPRB0792: Conesrved hypothetical protein	Conesrved hypothetical protein

CRON 66.
COG3016	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC2004: Conserved hypothetical iron-regulated protein	* Vibrio vulnificus CMCP6 Site: position = -114 score = 5.50325 sequence = TAAAGAGAATTATTCTCATTA Gene: VV1_2020: Conserved hypothetical iron-regulated protein	* Vibrio harveyi ATCC BAA-1116 Site: position = -80 score = 5.42701 sequence = TAACGCTAATTATTCTCATTA Gene: VIBHAR_03054: Conserved hypothetical iron-regulated protein	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -80 score = 5.45329 sequence = TAACGAAAATCATTCTCATTT Gene: VP2161: Conserved hypothetical iron-regulated protein	Vibrio shilonii AK1 Gene: VSAK1_10043: Conserved hypothetical iron-regulated protein	Vibrio splendidus LGP32 Gene: VS_0927: Conserved hypothetical iron-regulated protein	* Vibrio fischeri ES114 Site: position = -82 score = 5.47882 sequence = TACTGAGAATGATTCTTATTT Site: position = -66 score = 4.74066 sequence = TATTTATATTGATAATCATTT Site: position = -60 score = 5.52305 sequence = TATTGATAATCATTTCCATTT Gene: VF_A0756: Conserved hypothetical iron-regulated protein	* Vibrio salmonicida LFI1238 Site: position = -82 score = 5.17808 sequence = AGTTGATAATGATTACTATTA Gene: VSAL_II0868: Conserved hypothetical iron-regulated protein	* Vibrio angustum S14 Site: position = -93 score = 5.15586 sequence = AATTGATAATAACTCGTATTA Gene: VAS14_06553: Conserved hypothetical iron-regulated protein	* Photobacterium profundum SS9 Site: position = -190 score = 5.4434 sequence = TATTGATATTGATTATCAGTT Site: position = -167 score = 4.86396 sequence = ATTTGATAATCAATATCAACT Gene: PBPRA2792: Conserved hypothetical iron-regulated protein	Conserved hypothetical iron-regulated protein

CRON 67.
VC0877	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 20 score = 4.87186 sequence = AATTAATAATTATTCTCAAGG Gene: VC0877: hypothetical protein	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	hypothetical protein
yaeB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC0876: conserved hypothetical protein	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = -81 score = 5.14044 sequence = AATTAATAATCATTCTCAAAA Gene: VIBHAR_03251: hypothetical protein	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -81 score = 5.32437 sequence = AATTAATAATCATTCCCAATA Gene: VP2332: conserved hypothetical protein	Vibrio shilonii AK1 Gene: VSAK1_11800: hypothetical protein	* Vibrio splendidus LGP32 Site: position = -81 score = 5.6759 sequence = AAATGATAATTATTATCAAAA Gene: VS_2367: transcriptional regulator	Vibrio fischeri ES114 Gene: VF_0683: hypothetical protein	* Vibrio salmonicida LFI1238 Site: position = -89 score = 5.22112 sequence = AATTGCGAACTATTATCATAT Gene: VSAL_I0891: hypothetical protein	Vibrio angustum S14 Gene: VAS14_21071: hypothetical protein	Photobacterium profundum SS9 Gene: PBPRA2943: conserved hypothetical protein	conserved hypothetical protein

CRON 68.
ptrB	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -76 score = 5.73282 sequence = AAATGATAATTGATCTTATTT Gene: VCA0063: Protease II (EC 3.4.21.83)	* Vibrio vulnificus CMCP6 Site: position = -155 score = 5.77431 sequence = AATTGATATCTATTCTCATTT Site: position = -103 score = 5.3432 sequence = AAATGATAATTGATGTTATTT Gene: VV21548: Protease II (EC 3.4.21.83)	* Vibrio harveyi ATCC BAA-1116 Site: position = -80 score = 5.92547 sequence = AAATGATAATTGATCTCATTT Gene: VIBHAR_05127: Protease II (EC 3.4.21.83)	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -79 score = 5.92547 sequence = AAATGATAATTGATCTCATTT Gene: VPA1467: Protease II (EC 3.4.21.83)	Vibrio shilonii AK1	Vibrio splendidus LGP32	* Vibrio fischeri ES114 Site: position = -85 score = 4.35258 sequence = AAATGAAAATGATAATTGATC Site: position = -79 score = 5.54283 sequence = AAATGATAATTGATCTCATTC Gene: VF_A0333: Protease II (EC 3.4.21.83)	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -73 score = 4.9661 sequence = AAATGAGAATCATTCTTGATC Gene: PBPRB0979: Protease II (EC 3.4.21.83)	Protease II (EC 3.4.21.83)
hutR	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0064: TonB-dependent heme receptor HutR	Vibrio vulnificus CMCP6 Gene: VV21549: TonB-dependent heme receptor HutR	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05128: TonB-dependent heme receptor HutR	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1466: TonB-dependent heme receptor HutR	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0332: TonB-dependent heme receptor HutR	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB0978: TonB-dependent heme receptor HutR	TonB-dependent heme receptor HutR
VIBHAR_03587	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05129: hypothetical protein	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	hypothetical protein
VIBHAR_05130	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05130: hypothetical protein	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	hypothetical protein
VCA0065	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0065: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase	Vibrio vulnificus CMCP6 Gene: VV21550: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase	2 Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05131: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Gene: VIBHAR_05132: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1465: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0331: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB0977: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase	Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
VCA0066	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0066: Hypothetical protein in cluster with HutR, VCA0066 homolog	Vibrio vulnificus CMCP6 Gene: VV21551: Hypothetical protein in cluster with HutR, VCA0066 homolog	2 Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05133: Hypothetical protein in cluster with HutR, VCA0066 homolog Gene: VIBHAR_05134: Hypothetical protein in cluster with HutR, VCA0066 homolog	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1464: Hypothetical protein in cluster with HutR, VCA0066 homolog	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0330: Hypothetical protein in cluster with HutR, VCA0066 homolog	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB0976: Hypothetical protein in cluster with HutR, VCA0066 homolog	Hypothetical protein in cluster with HutR, VCA0066 homolog
VCA0067	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0067: Hypothetical protein in cluster with HutR, VCA0067 homolog	Vibrio vulnificus CMCP6 Gene: VV21552: Hypothetical protein in cluster with HutR, VCA0067 homolog	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05135: Hypothetical protein in cluster with HutR, VCA0067 homolog	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1463: Hypothetical protein in cluster with HutR, VCA0067 homolog	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0329: Hypothetical protein in cluster with HutR, VCA0067 homolog	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Hypothetical protein in cluster with HutR, VCA0067 homolog
PBPRB0975	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB0975: hypothetical protein	hypothetical protein

CRON 69.
vctP	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	* Vibrio fischeri ES114 Site: position = -65 score = 5.56805 sequence = TAATAATAACCATTTTCATTA Site: position = -34 score = 5.42656 sequence = AAATACGAATAGTTATCACTT Gene: VF_A0827: ferric anguibactin-binding protein	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	iron(III) ABC transporter, periplasmic iron-compound-binding protein
vctD	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0826: ferric anguibactin transport system permease protein FatD	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	iron(III) ABC transporter, permease protein
VCA0229	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0825: ferric anguibactin transport system permease protein FatC	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	iron(III) ABC transporter, permease protein
vctC	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114 Gene: VF_A0824: ferric anguibactin transport ATP-binding protein	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	iron(III) ABC transporter, ATP-binding protein
VIBHAR_06920	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = 4 score = 4.42241 sequence = GAAAGAGAATTGTTATCAAAA Gene: VIBHAR_06920: Siderophore-interacting protein ViuB	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0089: Siderophore-interacting protein ViuB	* Vibrio shilonii AK1 Site: position = -31 score = 5.38917 sequence = AAATGAAAACAATAATCATTA Gene: VSAK1_05955: Siderophore-interacting protein ViuB	* Vibrio splendidus LGP32 Site: position = -76 score = 5.2973 sequence = AAATGATAACTATTAGTATTG Gene: VS_II0412: Siderophore-interacting protein ViuB	Vibrio fischeri ES114 Gene: VF_A0823: Siderophore-interacting protein ViuB	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -29 score = 5.51071 sequence = AAATAAAAACCATTCTCAATT Gene: VAS14_04423: Siderophore-interacting protein ViuB	Photobacterium profundum SS9	Siderophore-interacting protein ViuB

CRON 70.
nrfB	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -144 score = 5.24875 sequence = AAATAAGAATTGATGTCATTT Site: position = -76 score = 5.5451 sequence = AATTGAAAATGATTCTTAATT Gene: VV1_3034: Cytochrome c-type protein NrfB precursor	* Vibrio harveyi ATCC BAA-1116 Site: position = -118 score = 5.24875 sequence = AAATAAGAATTGATGTCATTT Site: position = -46 score = 5.88896 sequence = AATTGAGAATAGTTATCAATT Gene: VIBHAR_02726: Cytochrome c-type protein NrfB precursor	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -140 score = 5.24875 sequence = AAATAAGAATTGATGTCATTT Site: position = -70 score = 5.31152 sequence = AGTTGAGAACAGTTATCAATT Gene: VP1928: Cytochrome c-type protein NrfB precursor	* Vibrio shilonii AK1 Site: position = -274 score = 5.71943 sequence = TGATGATATTAATTATCATTT Site: position = -125 score = 4.88862 sequence = AAATAAGAATTGATTACATTT Gene: VSAK1_05595: Cytochrome c-type protein NrfB precursor	* Vibrio splendidus LGP32 Site: position = -263 score = 5.40717 sequence = AACTGAGAATTATTATCATAT Site: position = -113 score = 5.73282 sequence = AAATAAGAATTGATATCATTT Gene: VS_1932: Cytochrome c-type protein NrfB precursor	* Vibrio fischeri ES114 Site: position = -264 score = 5.5546 sequence = TATTAAGAATGATTCTTATTT Gene: VF_1553: Cytochrome c-type protein NrfB precursor	* Vibrio salmonicida LFI1238 Site: position = -286 score = 5.4635 sequence = TATTAATAATGGTTCTTATTT Site: position = -127 score = 4.48097 sequence = CAATGAGAATTGATTTCAATG Gene: VSAL_I1998: Cytochrome c-type protein NrfB precursor	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -208 score = 4.75395 sequence = TAATGAGAATGGGTGTCAATT Site: position = -191 score = 5.09667 sequence = AATTGCAAATGGTTTTTATTT Gene: PBPRA1259: Cytochrome c-type protein NrfB precursor	Cytochrome c-type protein NrfB precursor
nfrC	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV1_3033: Putative nitrite reductase, Fe-S protein (NrfC)	2 Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02725: Putative nitrite reductase, Fe-S protein (NrfC) Gene: VIBHAR_02724: Putative nitrite reductase, Fe-S protein (NrfC)	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1927: Putative nitrite reductase, Fe-S protein (NrfC)	Vibrio shilonii AK1 Gene: VSAK1_05590: Putative nitrite reductase, Fe-S protein (NrfC)	Vibrio splendidus LGP32 Gene: VS_1931: Putative nitrite reductase, Fe-S protein (NrfC)	Vibrio fischeri ES114 Gene: VF_1552: Putative nitrite reductase, Fe-S protein (NrfC)	Vibrio salmonicida LFI1238 Gene: VSAL_I1999: Putative nitrite reductase, Fe-S protein (NrfC)	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRA1260: Putative nitrite reductase, Fe-S protein (NrfC)	Putative nitrite reductase, Fe-S protein (NrfC)
nrfD	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV1_3032: Putative nitrate reductase, formate dependent (NrfD)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02723: Putative nitrate reductase, formate dependent (NrfD)	Vibrio parahaemolyticus RIMD 2210633 Gene: VP1926: Putative nitrate reductase, formate dependent (NrfD)	Vibrio shilonii AK1 Gene: VSAK1_05585: Putative nitrate reductase, formate dependent (NrfD)	Vibrio splendidus LGP32 Gene: VS_1930: Putative nitrate reductase, formate dependent (NrfD)	Vibrio fischeri ES114 Gene: VF_1551: Putative nitrate reductase, formate dependent (NrfD)	Vibrio salmonicida LFI1238 Gene: VSAL_I2000: Putative nitrate reductase, formate dependent (NrfD)	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRA1261: Putative nitrate reductase, formate dependent (NrfD)	Putative nitrate reductase, formate dependent (NrfD)

CRON 71.
tonB-hmu	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -170 score = 5.33368 sequence = AATTGATAATTGCTATTATTA Gene: VCA0910: Periplasmic protein TonB involved in hemin uptake	* Vibrio vulnificus CMCP6 Site: position = -115 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Gene: VV21614: Periplasmic protein TonB involved in hemin uptake	* Vibrio harveyi ATCC BAA-1116 Site: position = -79 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Site: position = -34 score = 5.31682 sequence = AGTTGATAATGATTAGCAATA Gene: VIBHAR_05244: Periplasmic protein TonB involved in hemin uptake	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -74 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Gene: VPA0426: Periplasmic protein TonB involved in hemin uptake	2 Vibrio shilonii AK1* Site: position = -78 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Gene: VSAK1_22229: Periplasmic protein TonB involved in hemin uptake Gene: VSAK1_22224: Periplasmic protein TonB involved in hemin uptake	* Vibrio splendidus LGP32 Site: position = -67 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Gene: VS_II0289: Periplasmic protein TonB involved in hemin uptake	* Vibrio fischeri ES114 Site: position = -65 score = 5.68017 sequence = AATTGATAATTGATCTCATTA Gene: VF_1225: Periplasmic protein TonB involved in hemin uptake	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -190 score = 5.44464 sequence = AAATGATAATTGATATTATTC Gene: VAS14_03958: Periplasmic protein TonB involved in hemin uptake	* Photobacterium profundum SS9 Site: position = -196 score = 5.82117 sequence = AAATGATAATCAATCTTATTT Site: position = -141 score = 5.44464 sequence = AAATGATAATTGATATTATTC Gene: PBPRA2103: Periplasmic protein TonB involved in hemin uptake	Periplasmic protein TonB involved in hemin uptake
exbB-hmu	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0911: TonB system transport protein ExbB involved in hemin uptake	Vibrio vulnificus CMCP6 Gene: VV21613: TonB system transport protein ExbB involved in hemin uptake	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05243: TonB system transport protein ExbB involved in hemin uptake	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0425: TonB system transport protein ExbB involved in hemin uptake	Vibrio shilonii AK1 Gene: VSAK1_22219: TonB system transport protein ExbB involved in hemin uptake	Vibrio splendidus LGP32 Gene: VS_II0288: TonB system transport protein ExbB involved in hemin uptake	Vibrio fischeri ES114 Gene: VF_1224: TonB system transport protein ExbB involved in hemin uptake	Vibrio salmonicida LFI1238 Gene: VSAL_I1752: TonB system transport protein ExbB involved in hemin uptake	Vibrio angustum S14 Gene: VAS14_03963: TonB system transport protein ExbB involved in hemin uptake	Photobacterium profundum SS9 Gene: PBPRA2104: TonB system transport protein ExbB involved in hemin uptake	TonB system transport protein ExbB involved in hemin uptake
exbD-hmu	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0912: TonB system transport protein ExbD involved in hemin uptake	Vibrio vulnificus CMCP6 Gene: VV21612: TonB system transport protein ExbD involved in hemin uptake	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05242: TonB system transport protein ExbD involved in hemin uptake	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0424: TonB system transport protein ExbD involved in hemin uptake	Vibrio shilonii AK1 Gene: VSAK1_22214: TonB system transport protein ExbD involved in hemin uptake	Vibrio splendidus LGP32 Gene: VS_II0287: TonB system transport protein ExbD involved in hemin uptake	Vibrio fischeri ES114 Gene: VF_1223: TonB system transport protein ExbD involved in hemin uptake	Vibrio salmonicida LFI1238 Gene: VSAL_I1753: TonB system transport protein ExbD involved in hemin uptake	Vibrio angustum S14 Gene: VAS14_03968: TonB system transport protein ExbD involved in hemin uptake	Photobacterium profundum SS9 Gene: PBPRA2105: TonB system transport protein ExbD involved in hemin uptake	TonB system transport protein ExbD involved in hemin uptake
hmuT	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0913: Hemin ABC transporter, periplasmic hemin-binding protein	Vibrio vulnificus CMCP6 Gene: VV21611: Hemin ABC transporter, periplasmic hemin-binding protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05241: Hemin ABC transporter, periplasmic hemin-binding protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0423: Hemin ABC transporter, periplasmic hemin-binding protein	Vibrio shilonii AK1 Gene: VSAK1_22209: Hemin ABC transporter, periplasmic hemin-binding protein	Vibrio splendidus LGP32 Gene: VS_II0286: Hemin ABC transporter, periplasmic hemin-binding protein	Vibrio fischeri ES114 Gene: VF_1222: Hemin ABC transporter, periplasmic hemin-binding protein	Vibrio salmonicida LFI1238 Gene: VSAL_I1754: Hemin ABC transporter, periplasmic hemin-binding protein	Vibrio angustum S14 Gene: VAS14_03973: Hemin ABC transporter, periplasmic hemin-binding protein	Photobacterium profundum SS9 Gene: PBPRA2106: Hemin ABC transporter, periplasmic hemin-binding protein	Hemin ABC transporter, periplasmic hemin-binding protein
hmuU	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0914: Hemin ABC transporter, permease component	Vibrio vulnificus CMCP6 Gene: VV21610: Hemin ABC transporter, permease component	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05240: Hemin ABC transporter, permease component	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0422: Hemin ABC transporter, permease component	Vibrio shilonii AK1 Gene: VSAK1_22204: Hemin ABC transporter, permease component	Vibrio splendidus LGP32 Gene: VS_II0285: Hemin ABC transporter, permease component	Vibrio fischeri ES114 Gene: VF_1221: Hemin ABC transporter, permease component	Vibrio salmonicida LFI1238 Gene: VSAL_I1755: Hemin ABC transporter, permease component	Vibrio angustum S14 Gene: VAS14_03978: Hemin ABC transporter, permease component	Photobacterium profundum SS9 Gene: PBPRA2107: Hemin ABC transporter, permease component	Hemin ABC transporter, permease component
hmuV	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0915: Hemin ABC transporter, ATP-binding subunit	Vibrio vulnificus CMCP6 Gene: VV21609: Hemin ABC transporter, ATP-binding subunit	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05239: Hemin ABC transporter, ATP-binding subunit	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0421: Hemin ABC transporter, ATP-binding subunit	Vibrio shilonii AK1 Gene: VSAK1_22199: Hemin ABC transporter, ATP-binding subunit	Vibrio splendidus LGP32 Gene: VS_II0284: Hemin ABC transporter, ATP-binding subunit	Vibrio fischeri ES114 Gene: VF_1220: Hemin ABC transporter, ATP-binding subunit	Vibrio salmonicida LFI1238 Gene: VSAL_I1756: Hemin ABC transporter, ATP-binding subunit	Vibrio angustum S14 Gene: VAS14_03983: Hemin ABC transporter, ATP-binding subunit	Photobacterium profundum SS9 Gene: PBPRA2108: Hemin ABC transporter, ATP-binding subunit	Hemin ABC transporter, ATP-binding subunit

CRON 72.
fhuE	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	* Vibrio harveyi ATCC BAA-1116 Site: position = -97 score = 5.4355 sequence = AAATGGTAATAGTTGTCATTT Gene: VIBHAR_06761: Putative ferrichrome-iron receptor	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -98 score = 5.33163 sequence = AAATGGTAATACTTATCACTT Gene: VPA0150: Putative ferrichrome-iron receptor	Vibrio shilonii AK1	* Vibrio splendidus LGP32 Site: position = -124 score = 5.42376 sequence = AAATAGTAATAGTTATCACTT Gene: VS_II0677: Putative ferrichrome-iron receptor	* Vibrio fischeri ES114 Site: position = -83 score = 5.91957 sequence = AAATGGTAACAATTATCATTT Gene: VF_A0191: Putative ferrichrome-iron receptor	* Vibrio salmonicida LFI1238 Site: position = -82 score = 5.75632 sequence = AAATAAAAACGATTATCATTT Gene: VSAL_II0110: Putative ferrichrome-iron receptor	* Vibrio angustum S14 Site: position = -189 score = 5.51921 sequence = AAATGGTAATGGTTATCACTT Gene: VAS14_12509: Putative ferrichrome-iron receptor	* Photobacterium profundum SS9 Site: position = -160 score = 5.71365 sequence = AAATGCTAACAATTATCACTT Gene: PBPRB1222: Putative ferrichrome-iron receptor	Putative ferrichrome-iron receptor
PF11932	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -58 score = 4.76526 sequence = TAATGAGAGCGTTTCTCAATA Gene: VC1548: hypothetical protein	* Vibrio vulnificus CMCP6 Site: position = -58 score = 5.74796 sequence = TAATGCGAATAAATATCATTT Gene: VV20364: hypothetical protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06760: hypothetical protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0151: hypothetical protein	* Vibrio shilonii AK1 Site: position = -225 score = 5.3043 sequence = AAATGATAACTCATATCAATA Gene: VSAK1_26760: hypothetical protein	* Vibrio splendidus LGP32 Site: position = -61 score = 4.85912 sequence = TAATGAGACTGCTTATCAATA Gene: VS_II0678: hypothetical protein	Vibrio fischeri ES114 Gene: VF_A0192: hypothetical protein	Vibrio salmonicida LFI1238 Gene: VSAL_II0111: hypothetical protein	Vibrio angustum S14 Gene: VAS14_12504: hypothetical protein	* Photobacterium profundum SS9 Site: position = -98 score = 5.62308 sequence = AAATGAGATTCATTTTCAATT Site: position = -20 score = 4.44474 sequence = AAATACTATTGATGAGCAATA Gene: PBPRB0694: hypothetical protein	hypothetical protein
exbB1	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1547: Biopolymer transport protein ExbB-related protein	Vibrio vulnificus CMCP6 Gene: VV20363: Biopolymer transport protein ExbB-related protein	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06759: Biopolymer transport protein ExbB-related protein	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0152: Biopolymer transport protein ExbB-related protein	Vibrio shilonii AK1 Gene: VSAK1_26755: Biopolymer transport protein ExbB-related protein	Vibrio splendidus LGP32 Gene: VS_II0679: Biopolymer transport protein ExbB-related protein	Vibrio fischeri ES114 Gene: VF_A0193: Biopolymer transport protein ExbB-related protein	Vibrio salmonicida LFI1238 Gene: VSAL_II0112: Biopolymer transport protein ExbB-related protein	Vibrio angustum S14 Gene: VAS14_12499: Biopolymer transport protein ExbB-related protein	Photobacterium profundum SS9 Gene: PBPRB0695: Biopolymer transport protein ExbB-related protein	Biopolymer transport protein ExbB-related protein
exbB2	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1546: TonB system transport protein ExbB2	Vibrio vulnificus CMCP6 Gene: VV20362: TonB system transport protein ExbB2	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06758: TonB system transport protein ExbB2	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0153: TonB system transport protein ExbB2	Vibrio shilonii AK1 Gene: VSAK1_26750: TonB system transport protein ExbB2	Vibrio splendidus LGP32 Gene: VS_II0680: TonB system transport protein ExbB2	Vibrio fischeri ES114 Gene: VF_A0194: TonB system transport protein ExbB2	Vibrio salmonicida LFI1238 Gene: VSAL_II0113: TonB system transport protein ExbB2	Vibrio angustum S14 Gene: VAS14_12494: TonB system transport protein ExbB2	Photobacterium profundum SS9 Gene: PBPRB0696: TonB system transport protein ExbB2	TonB system transport protein ExbB2
exbD2	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV20361: TonB system transport protein ExbD2	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06757: TonB system transport protein ExbD2	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0154: TonB system transport protein ExbD2	Vibrio shilonii AK1 Gene: VSAK1_26745: TonB system transport protein ExbD2	Vibrio splendidus LGP32 Gene: VS_II0681: TonB system transport protein ExbD2	Vibrio fischeri ES114 Gene: VF_A0195: TonB system transport protein ExbD2	Vibrio salmonicida LFI1238 Gene: VSAL_II0114: TonB system transport protein ExbD2	Vibrio angustum S14 Gene: VAS14_12489: TonB system transport protein ExbD2	Photobacterium profundum SS9 Gene: PBPRB0697: TonB system transport protein ExbD2	TonB system transport protein ExbD2
tonB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1544: Periplasmic protein TonB	Vibrio vulnificus CMCP6 Gene: VV20360: Periplasmic protein TonB	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06756: Periplasmic protein TonB	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0155: Periplasmic protein TonB	Vibrio shilonii AK1 Gene: VSAK1_26740: Periplasmic protein TonB	Vibrio splendidus LGP32 Gene: VS_II0682: Periplasmic protein TonB	Vibrio fischeri ES114 Gene: VF_A0196: Periplasmic protein TonB	Vibrio salmonicida LFI1238 Gene: VSAL_II0115: Periplasmic protein TonB	Vibrio angustum S14 Gene: VAS14_12484: Periplasmic protein TonB	Photobacterium profundum SS9 Gene: PBPRB0698: Periplasmic protein TonB	Periplasmic protein TonB
VC1543	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VC1543: TPR domain protein, putative component of TonB system	Vibrio vulnificus CMCP6 Gene: VV20359: TPR domain protein, putative component of TonB system	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06755: TPR domain protein, putative component of TonB system	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0156: TPR domain protein, putative component of TonB system	Vibrio shilonii AK1 Gene: VSAK1_26735: TPR domain protein, putative component of TonB system	Vibrio splendidus LGP32 Gene: VS_II0683: TPR domain protein, putative component of TonB system	Vibrio fischeri ES114 Gene: VF_A0197: TPR domain protein, putative component of TonB system	Vibrio salmonicida LFI1238 Gene: VSAL_II0116: TPR domain protein, putative component of TonB system	Vibrio angustum S14 Gene: VAS14_12479: TPR domain protein, putative component of TonB system	Photobacterium profundum SS9 Gene: PBPRB0699: TPR domain protein, putative component of TonB system	TPR domain protein, putative component of TonB system

CRON 73.
feoA	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -242 score = 4.83329 sequence = AGATAATATTTATTCTGATTA Site: position = -42 score = 5.80368 sequence = AAATAATAATATTTATCATTA Gene: VP0857: Ferrous iron transport protein A	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9	Ferrous iron transport protein A

CRON 74.
sitA	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	* Vibrio angustum S14 Site: position = -83 score = 4.75015 sequence = TAATAATTATCAATTGCATTT Site: position = -89 score = 6.07483 sequence = TATTGATAATAATTATCAATT Gene: VAS14_10539: Manganese ABC transporter, periplasmic-binding protein SitA	Photobacterium profundum SS9	Manganese ABC transporter, periplasmic-binding protein SitA
sitB	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_10534: Manganese ABC transporter, ATP-binding protein SitB	Photobacterium profundum SS9	Manganese ABC transporter, ATP-binding protein SitB
sitC	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_10529: Manganese ABC transporter, inner membrane permease protein SitC	Photobacterium profundum SS9	Manganese ABC transporter, inner membrane permease protein SitC
sitD	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_10524: Manganese ABC transporter, inner membrane permease protein SitD	Photobacterium profundum SS9	Manganese ABC transporter, inner membrane permease protein SitD

CRON 75.
VV20568	Vibrio cholerae O1 biovar eltor str. N16961	* Vibrio vulnificus CMCP6 Site: position = -317 score = 6.20547 sequence = AAATGATAATAAATATCATTT Gene: VV20568: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Vibrio harveyi ATCC BAA-1116 Site: position = -197 score = 4.57184 sequence = CAATGTAAATGGTTCTCAATT Gene: VIBHAR_06272: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -252 score = 5.00459 sequence = TAATGTAAATGGTTCTCAATT Gene: VPA0536: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Vibrio shilonii AK1 Gene: VSAK1_17012: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Vibrio splendidus LGP32 Gene: VS_II0365: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_21827: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Photobacterium profundum SS9 Gene: PBPRA0167: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)	Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
VV20567	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV20567: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06271: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0537: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Vibrio shilonii AK1 Gene: VSAK1_17007: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Vibrio splendidus LGP32 Gene: VS_II0366: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_21822: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Photobacterium profundum SS9 Gene: PBPRA0168: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
VV20566	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV20566: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06270: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0538: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Vibrio shilonii AK1 Gene: VSAK1_17002: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Vibrio splendidus LGP32 Gene: VS_II0367: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_21817: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Photobacterium profundum SS9 Gene: PBPRA0169: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1	Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
VV20565	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6 Gene: VV20565: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06269: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA0539: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Vibrio shilonii AK1 Gene: VSAK1_16997: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Vibrio splendidus LGP32 Gene: VS_II0368: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14 Gene: VAS14_21812: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Photobacterium profundum SS9 Gene: PBPRA0170: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)	Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

CRON 76.
feoA	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	* Photobacterium profundum SS9 Site: position = -97 score = 5.23365 sequence = AAACTATAATAGTTATCATTT Gene: PBPRB1905: Ferrous iron transport protein A	Ferrous iron transport protein A
feoB	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio vulnificus CMCP6	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio fischeri ES114	Vibrio salmonicida LFI1238	Vibrio angustum S14	Photobacterium profundum SS9 Gene: PBPRB1904: Ferrous iron transport protein B	Ferrous iron transport protein B

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Fur - Vibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --