Regulog Fur - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By trascription factor - FUR
- By TF family - FUR
- By effector - Iron ion, (Fe2+)
- By pathway - Iron homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | 63 | 32 |
| Vibrio vulnificus CMCP6 | 77 | 37 |
| Vibrio harveyi ATCC BAA-1116 | 94 | 45 |
| Vibrio parahaemolyticus RIMD 2210633 | 91 | 40 |
| Vibrio shilonii AK1 | 67 | 37 |
| Vibrio splendidus LGP32 | 90 | 42 |
| Vibrio fischeri ES114 | 70 | 24 |
| Vibrio salmonicida LFI1238 | 54 | 21 |
| Vibrio angustum S14 | 64 | 28 |
| Photobacterium profundum SS9 | 71 | 28 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| hutW |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -107 score = 5.33368 sequence = TAATAATAGCAATTATCAATT Gene: VCA0909: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
*
Vibrio vulnificus CMCP6 Site: position = -108 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Gene: VV21615: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -109 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Site: position = -154 score = 5.31682 sequence = TATTGCTAATCATTATCAACT Gene: VIBHAR_05245: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -109 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Gene: VPA0427: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
*
Vibrio shilonii AK1 Site: position = -107 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Gene: VSAK1_22234: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
*
Vibrio splendidus LGP32 Site: position = -108 score = 5.58166 sequence = AAATAAGATCAATTATCAATT Gene: VS_II0290: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
*
Vibrio fischeri ES114 Site: position = -100 score = 5.68017 sequence = TAATGAGATCAATTATCAATT Gene: VF_1226: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
*
Vibrio salmonicida LFI1238 Site: position = -147 score = 5.77431 sequence = AAATGAGATCAATTATCAATT Gene: VSAL_I1750: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
|
*
Photobacterium profundum SS9 Site: position = -287 score = 5.82117 sequence = AAATAAGATTGATTATCATTT Site: position = -342 score = 5.44464 sequence = GAATAATATCAATTATCATTT Gene: PBPRA2102: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake |
| huvX |
Gene: VCA0908: Putative heme iron utilization protein |
Gene: VV21616: Putative heme iron utilization protein |
Gene: VIBHAR_05246: Putative heme iron utilization protein |
Gene: VPA0428: Putative heme iron utilization protein |
Gene: VSAK1_22239: Putative heme iron utilization protein |
Gene: VS_II0291: Putative heme iron utilization protein |
Gene: VF_1227: Putative heme iron utilization protein |
Gene: VSAL_I1749: Putative heme iron utilization protein |
*
Vibrio angustum S14 Site: position = -206 score = 5.44464 sequence = GAATAATATCAATTATCATTT Gene: VAS14_03953: Putative heme iron utilization protein |
Gene: PBPRA2101: Putative heme iron utilization protein |
Putative heme iron utilization protein |
| hutZ |
Gene: VCA0907: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: VV21617: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: VIBHAR_05247: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: VPA0429: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: VSAK1_22244: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: VS_II0292: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: VF_1228: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: VSAL_I1748: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: VAS14_03948: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Gene: PBPRA2100: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ |
| CRON 2. | |||||||||||
| feoA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -46 score = 5.05628 sequence = TAATAGTAATATTTCTTATTA Gene: VC2078: Ferrous iron transport protein A |
*
Vibrio vulnificus CMCP6 Site: position = -42 score = 5.46965 sequence = TAATAAAAATATTTCTCATTT Gene: VV1_0149: Ferrous iron transport protein A |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -42 score = 5.70954 sequence = TAATAATAATATTTATCATTA Gene: VIBHAR_01363: Ferrous iron transport protein A |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -36 score = 4.40561 sequence = TAATATTTATCATTAGCAATA Site: position = -42 score = 5.80368 sequence = AAATAATAATATTTATCATTA Gene: VP0857: Ferrous iron transport protein A |
*
Vibrio shilonii AK1 Site: position = -45 score = 5.20311 sequence = TAATGTTAATATTTCTCATTA Gene: VSAK1_09003: Ferrous iron transport protein A |
*
Vibrio splendidus LGP32 Site: position = -42 score = 5.03381 sequence = TAATAACAATCTTTCTCATTA Gene: VS_2234: Ferrous iron transport protein A |
*
Vibrio fischeri ES114 Site: position = -35 score = 5.68968 sequence = AAATAATAATGATTCTCACTA Gene: VF_0833: Ferrous iron transport protein A |
*
Vibrio salmonicida LFI1238 Site: position = -35 score = 5.68968 sequence = AAATAATAATGATTCTCACTA Gene: VSAL_I2257: Ferrous iron transport protein A |
*
Vibrio angustum S14 Site: position = -36 score = 5.82114 sequence = AAATGCTAATAATTCTTATTA Gene: VAS14_17796: Ferrous iron transport protein A |
*
Photobacterium profundum SS9 Site: position = -36 score = 5.62849 sequence = AAATACTAATAATTCTTATTA Gene: PBPRA1058: Ferrous iron transport protein A |
Ferrous iron transport protein A |
| feoB |
Gene: VC2077: Ferrous iron transport protein B |
Gene: VV1_0148: Ferrous iron transport protein B |
Gene: VIBHAR_01364: Ferrous iron transport protein B |
Gene: VP0858: Ferrous iron transport protein B |
Gene: VSAK1_09008: Ferrous iron transport protein B |
Gene: VS_2233: Ferrous iron transport protein B |
Gene: VF_0834: Ferrous iron transport protein B |
Gene: VSAL_I2258: Ferrous iron transport protein B |
*2
Vibrio angustum S14 Site: position = -82 score = 5.14923 sequence = AAGTGATAAGCGATATCATTT Gene: VAS14_04118: Ferrous iron transport protein B Gene: VAS14_17801: Ferrous iron transport protein B |
Gene: PBPRA1059: Ferrous iron transport protein B |
Ferrous iron transport protein B |
| feoC |
Gene: VC2076: Ferrous iron transport protein C |
Gene: VV1_0147: Ferrous iron transport protein C |
Gene: VIBHAR_01365: Ferrous iron transport protein C |
Gene: VP0859: Ferrous iron transport protein C |
Gene: VSAK1_09013: Ferrous iron transport protein C |
Gene: VS_2232: Ferrous iron transport protein C |
Gene: VF_0835: Ferrous iron transport protein C |
Gene: VSAL_I2259: Ferrous iron transport protein C |
2
Vibrio angustum S14 Gene: VAS14_17806: Ferrous iron transport protein C Gene: VAS14_04123: Ferrous iron transport protein C |
Gene: PBPRA1060: Ferrous iron transport protein C |
Ferrous iron transport protein C |
| CRON 3. | |||||||||||
| COG3315 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 10 score = 4.92067 sequence = ATTTGAGATTCATTATCATCT Site: position = -23 score = 4.36134 sequence = TGTTGAGATAAATTCTCAACA Gene: VC0091: O-Methyltransferase involved in polyketide biosynthesis |
*
Vibrio vulnificus CMCP6 Site: position = -55 score = 5.86572 sequence = AATTGAGATTTATTATCATTA Gene: VV1_1167: O-Methyltransferase involved in polyketide biosynthesis |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -57 score = 5.47382 sequence = TATTGAGATTTATTATCATCT Gene: VIBHAR_00267: O-Methyltransferase involved in polyketide biosynthesis |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -2 score = 5.56521 sequence = AATTGATATTCATTATCATCT Gene: VP2944: O-Methyltransferase involved in polyketide biosynthesis |
*
Vibrio shilonii AK1 Site: position = -2 score = 5.53584 sequence = AAATGACATTAGTTATCATTT Gene: VSAK1_13246: O-Methyltransferase involved in polyketide biosynthesis |
*
Vibrio splendidus LGP32 Site: position = -43 score = 5.56521 sequence = AATTGATATTCATTATCATCT Site: position = -76 score = 5.1063 sequence = TATTGATATTTACTCTCAATA Gene: VS_3005: O-Methyltransferase involved in polyketide biosynthesis |
*
Vibrio fischeri ES114 Site: position = -47 score = 5.86303 sequence = TAATGATAGTTATTATCATTT Site: position = -53 score = 4.37104 sequence = AAGTGGTAATGATAGTTATTA Gene: VF_2441: O-Methyltransferase involved in polyketide biosynthesis |
*
Vibrio salmonicida LFI1238 Site: position = -34 score = 5.37394 sequence = TAATGATAGTCATTATCATCT Site: position = -40 score = 4.71569 sequence = AATTGGTAATGATAGTCATTA Gene: VSAL_I2892: O-Methyltransferase involved in polyketide biosynthesis |
*
Vibrio angustum S14 Site: position = -42 score = 5.65981 sequence = AACTGATAATTATTATCATCT Gene: VAS14_21832: O-Methyltransferase involved in polyketide biosynthesis |
*
Photobacterium profundum SS9 Site: position = -45 score = 5.37394 sequence = TAATGATAGTCATTATCATCT Gene: PBPRA0166: O-Methyltransferase involved in polyketide biosynthesis |
O-Methyltransferase involved in polyketide biosynthesis |
| CRON 4. | |||||||||||
| irgB |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -131 score = 6.03303 sequence = AAATGATAATTATTCTTAATT Gene: VC0474: Iron-regulated virulence regulatory protein irgB |
|
Gene: VIBHAR_07055: Iron-regulated virulence regulatory protein irgB |
*3
Vibrio parahaemolyticus RIMD 2210633 Site: position = -124 score = 6.03029 sequence = AATTGATAATGATTATTATTT Gene: VP2603: Iron-regulated virulence regulatory protein irgB Gene: VPA1747: Iron-regulated virulence regulatory protein irgB Gene: VPA0912: Iron-regulated virulence regulatory protein irgB |
|
|
Gene: VF_A0791: Iron-regulated virulence regulatory protein irgB |
|
Gene: VAS14_11319: Iron-regulated virulence regulatory protein irgB |
|
Iron-regulated virulence regulatory protein irgB |
| CRON 5. | |||||||||||
| COG0778 |
|
Gene: VV1_3131: Nitroreductase |
Gene: VIBHAR_03042: Nitroreductase |
Gene: VP2150: Nitroreductase |
*
Vibrio shilonii AK1 Site: position = -87 score = 5.07431 sequence = GATTGAGAACAGTTCTCACTT Gene: VSAK1_03499: Nitroreductase |
*
Vibrio splendidus LGP32 Site: position = -76 score = 4.54844 sequence = CGTTGAGATTTATTATCGTTT Gene: VS_0939: Nitroreductase |
|
|
*
Vibrio angustum S14 Site: position = -30 score = 5.26267 sequence = AAAAAATAACTATTTTCATTT Gene: VAS14_05758: Nitroreductase |
*
Photobacterium profundum SS9 Site: position = -19 score = 4.34448 sequence = TTGTAAGAGCAATTATTATTT Gene: PBPRA2593: Nitroreductase |
Nitroreductase |
| CRON 6. | |||||||||||
| COG4771 |
|
|
Gene: VIBHAR_01404: Outer membrane receptor for ferrienterochelin, TonB-dependent |
|
*
Vibrio shilonii AK1 Site: position = -39 score = 5.77725 sequence = AAATGCAAACTATTATCATTT Gene: VSAK1_03309: Outer membrane receptor for ferrienterochelin, TonB-dependent |
*
Vibrio splendidus LGP32 Site: position = -88 score = 5.53559 sequence = AAATGATAACCATTACTATTA Gene: VS_2395: Outer membrane receptor for ferrienterochelin, TonB-dependent |
|
|
|
*
Photobacterium profundum SS9 Site: position = -43 score = 5.50187 sequence = TAACGATAATAATTATCATTC Gene: PBPRB1825: Outer membrane receptor for ferrienterochelin, TonB-dependent |
Outer membrane receptor for ferrienterochelin, TonB-dependent |
| CRON 7. | |||||||||||
| irpA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -2 score = 5.81164 sequence = AAATGATAATAATTTGCAATT Gene: VC1264: Iron-regulated protein A precursor |
*
Vibrio vulnificus CMCP6 Site: position = -38 score = 5.51797 sequence = AAATAAGAATAATTAGCACTA Gene: VV1_2968: Iron-regulated protein A precursor |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -51 score = 5.51797 sequence = AAATAAGAATAATTAGCACTA Gene: VIBHAR_02715: Iron-regulated protein A precursor |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -33 score = 5.51797 sequence = AAATAAGAATAATTAGCACTA Gene: VP1920: Iron-regulated protein A precursor |
*
Vibrio shilonii AK1 Site: position = -55 score = 5.71061 sequence = AAATGATAATAATTCGCACTA Gene: VSAK1_04580: Iron-regulated protein A precursor |
*
Vibrio splendidus LGP32 Site: position = -61 score = 5.28274 sequence = AAATGATAATGGTTTGCACTA Gene: VS_1923: Iron-regulated protein A precursor |
*
Vibrio fischeri ES114 Site: position = -132 score = 5.39528 sequence = AAATGATAAGGATTTGCATTT Site: position = -87 score = 5.94493 sequence = AAATAAAAATTATTATCATTA Gene: VF_1190: Iron-regulated protein A precursor |
*
Vibrio salmonicida LFI1238 Site: position = -83 score = 5.70043 sequence = AAATAACAATAATTATCATTA Site: position = -128 score = 5.48784 sequence = TAATGATAAATATTTGCATTT Gene: VSAL_I1786: Iron-regulated protein A precursor |
*
Vibrio angustum S14 Site: position = -73 score = 5.69578 sequence = TAATAATAACAATTATCACTT Site: position = -141 score = 5.5025 sequence = AAATGCAAATTATTACCATTA Gene: VAS14_01246: Iron-regulated protein A precursor |
|
Iron-regulated protein A precursor |
| CRON 8. | |||||||||||
| viuP |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -2 score = 4.87378 sequence = AAATGAGAATCAATATTACAA Site: position = 16 score = 4.79459 sequence = CAATGAAAAACATTTTTATTT Gene: VC0776: Ferric vibriobactin, enterobactin transport system, substrate-binding protein ViuP (TC 3.A.1.14.6) |
|
|
|
|
*
Vibrio splendidus LGP32 Site: position = -98 score = 4.97029 sequence = AAATGAGAATCAATGTAATTT Gene: VS_1123: Ferric vibriobactin, enterobactin transport system, substrate-binding protein ViuP (TC 3.A.1.14.6) |
|
|
|
|
Ferric vibriobactin, enterobactin transport system, substrate-binding protein ViuP (TC 3.A.1.14.6) |
| viuD |
Gene: VC0777: Ferric vibriobactin, enterobactin transport system, permease protein ViuD (TC 3.A.1.14.6) |
|
|
|
|
Gene: VS_1124: Ferric vibriobactin, enterobactin transport system, permease protein ViuD (TC 3.A.1.14.6) |
|
|
|
|
Ferric vibriobactin, enterobactin transport system, permease protein ViuD (TC 3.A.1.14.6) |
| viuG |
Gene: VC0778: Ferric vibriobactin, enterobactin transport system, permease protein ViuG (TC 3.A.1.14.6) |
|
|
|
|
Gene: VS_1125: Ferric vibriobactin, enterobactin transport system, permease protein ViuG (TC 3.A.1.14.6) |
|
|
|
|
Ferric vibriobactin, enterobactin transport system, permease protein ViuG (TC 3.A.1.14.6) |
| CRON 9. | |||||||||||
| VPA0663 |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -2 score = 5.38 sequence = TAATGATAATAATTCTCAGGT Gene: VPA0663: putative transcriptional regulator, AraC/XylS family |
|
*
Vibrio splendidus LGP32 Site: position = -2 score = 5.93749 sequence = AAATGATAATAATTATCAATC Gene: VS_II0528: putative transcriptional regulator, AraC/XylS family |
|
|
|
|
putative transcriptional regulator, AraC/XylS family |
| CRON 10. | |||||||||||
| COG2910 |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -46 score = 4.48214 sequence = TGATGTAAAGTATTCTCATTA Gene: VIBHAR_02532: Putative NADH-flavin reductase |
|
*
Vibrio shilonii AK1 Site: position = -18 score = 4.57373 sequence = AAATTATTATCATTATCAATG Site: position = -24 score = 5.13564 sequence = TAGTGTAAATTATTATCATTA Gene: VSAK1_01252: Putative NADH-flavin reductase |
|
|
|
*
Vibrio angustum S14 Site: position = -48 score = 5.58897 sequence = TAATGCAAACTATTATCATTA Gene: VAS14_10719: Putative NADH-flavin reductase |
*
Photobacterium profundum SS9 Site: position = -46 score = 4.55338 sequence = TAATACGAATTAGAATCATTA Gene: PBPRB1864: Putative NADH-flavin reductase |
Putative NADH-flavin reductase |
| CRON 11. | |||||||||||
| PF07690 |
|
|
|
|
Gene: VSAK1_20934: MFS transporter |
*
Vibrio splendidus LGP32 Site: position = -49 score = 4.39733 sequence = AAATCAAAATGATAATTATTC Site: position = -43 score = 4.72169 sequence = AAATGATAATTATTCGCTAAA Gene: VS_2111: MFS transporter |
*
Vibrio fischeri ES114 Site: position = -76 score = 5.56229 sequence = TAATGATAATTATTTTTATTC Site: position = -82 score = 5.01397 sequence = AAATGTTAATGATAATTATTT Gene: VF_A0157: MFS transporter |
*
Vibrio salmonicida LFI1238 Site: position = -150 score = 4.56715 sequence = AAATAGTAATGATAATTGTTT Site: position = -144 score = 5.37674 sequence = TAATGATAATTGTTTTTATTC Gene: VSAL_II0149: MFS transporter |
|
|
MFS transporter |
| CRON 12. | |||||||||||
| VSAK1_18252 |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -78 score = 6.27995 sequence = TAATGATAATGATTATCATTT Site: position = -72 score = 4.52617 sequence = TAATGATTATCATTTTAATCT Gene: VSAK1_18252: TonB-dependent heme receptor |
|
|
|
|
|
TonB-dependent heme receptor |
| CRON 13. | |||||||||||
| VPA0882 |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -80 score = 5.67039 sequence = TAATGATAGTAATTATTATTT Site: position = -64 score = 4.41889 sequence = TATTTAGATCCATTAACATTT Site: position = -86 score = 4.67356 sequence = AAATGATAATGATAGTAATTA Gene: VPA0882: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
|
|
|
|
|
|
TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
| CRON 14. | |||||||||||
| vctP |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 28 score = 4.87655 sequence = TAATGAGAATAAGTATCAAAA Gene: VCA0227: iron(III) ABC transporter, periplasmic iron-compound-binding protein |
Gene: VV20842: iron(III) ABC transporter, periplasmic iron-compound-binding protein |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -31 score = 4.68282 sequence = GCATGATAACGGATCTCATTA Gene: VIBHAR_06135: iron(III) ABC transporter, periplasmic iron-compound-binding protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -33 score = 4.96556 sequence = GCATGATAATAGATCTCATTA Gene: VPA0657: iron(III) ABC transporter, periplasmic iron-compound-binding protein |
*
Vibrio shilonii AK1 Site: position = -79 score = 5.64765 sequence = AAATGATATTGATTCCCATTT Site: position = -52 score = 4.69244 sequence = AAGTGATAATGATTCTGTTTA Gene: VSAK1_21214: iron(III) ABC transporter, periplasmic iron-compound-binding protein |
*
Vibrio splendidus LGP32 Site: position = -129 score = 5.73695 sequence = AATTGATAATAGTTCTCACTT Gene: VS_II1071: iron(III) ABC transporter, periplasmic iron-compound-binding protein |
*
Vibrio fischeri ES114 Site: position = -65 score = 5.56805 sequence = TAATAATAACCATTTTCATTA Site: position = -34 score = 5.42656 sequence = AAATACGAATAGTTATCACTT Gene: VF_A0827: iron(III) ABC transporter, periplasmic iron-compound-binding protein |
|
|
|
iron(III) ABC transporter, periplasmic iron-compound-binding protein |
| vctD |
Gene: VCA0228: Iron(III) ABC transporter, permease protein |
Gene: VV20110: Iron(III) ABC transporter, permease protein |
*2
Vibrio harveyi ATCC BAA-1116 Site: position = -320 score = 5.06617 sequence = TGATAGGATTAATTATCATTT Gene: VIBHAR_02108: Iron(III) ABC transporter, permease protein Gene: VIBHAR_06134: Iron(III) ABC transporter, permease protein |
Gene: VPA0658: Iron(III) ABC transporter, permease protein |
Gene: VSAK1_21219: Iron(III) ABC transporter, permease protein |
Gene: VS_II1070: Iron(III) ABC transporter, permease protein |
Gene: VF_A0826: Iron(III) ABC transporter, permease protein |
|
|
|
Iron(III) ABC transporter, permease protein |
| vctB |
Gene: VCA0229: Iron(III) ABC transporter, permease protein |
Gene: VV20111: Iron(III) ABC transporter, permease protein |
2
Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02107: Iron(III) ABC transporter, permease protein Gene: VIBHAR_06133: Iron(III) ABC transporter, permease protein |
Gene: VPA0659: Iron(III) ABC transporter, permease protein |
Gene: VSAK1_21224: Iron(III) ABC transporter, permease protein |
Gene: VS_II1068: Iron(III) ABC transporter, permease protein |
Gene: VF_A0825: Iron(III) ABC transporter, permease protein |
|
|
|
Iron(III) ABC transporter, permease protein |
| vctC |
Gene: VCA0230: Iron(III) ABC transporter, ATP-binding protein |
Gene: VV20112: Iron(III) ABC transporter, ATP-binding protein |
Gene: VIBHAR_06132: Iron(III) ABC transporter, ATP-binding protein |
Gene: VPA0660: Iron(III) ABC transporter, ATP-binding protein |
Gene: VSAK1_21229: Iron(III) ABC transporter, ATP-binding protein |
Gene: VS_II1067: Iron(III) ABC transporter, ATP-binding protein |
Gene: VF_A0824: Iron(III) ABC transporter, ATP-binding protein |
|
|
|
Iron(III) ABC transporter, ATP-binding protein |
| viuB |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = 4 score = 4.42241 sequence = GAAAGAGAATTGTTATCAAAA Gene: VIBHAR_06920: Siderophore-interacting protein ViuB |
Gene: VPA0089: Siderophore-interacting protein ViuB |
*
Vibrio shilonii AK1 Site: position = -31 score = 5.38917 sequence = AAATGAAAACAATAATCATTA Gene: VSAK1_05955: Siderophore-interacting protein ViuB |
*
Vibrio splendidus LGP32 Site: position = -76 score = 5.2973 sequence = AAATGATAACTATTAGTATTG Gene: VS_II0412: Siderophore-interacting protein ViuB |
Gene: VF_A0823: Siderophore-interacting protein ViuB |
|
*
Vibrio angustum S14 Site: position = -29 score = 5.51071 sequence = AAATAAAAACCATTCTCAATT Gene: VAS14_04423: Siderophore-interacting protein ViuB |
|
Siderophore-interacting protein ViuB |
| VV20841 |
|
*
Vibrio vulnificus CMCP6 Site: position = -113 score = 5.54227 sequence = AAATGGTAATAATAATCATTT Gene: VV20841: Aryl carrier domain |
|
|
|
|
|
|
|
|
Aryl carrier domain |
| CRON 15. | |||||||||||
| PF03929 |
|
|
Gene: VIBHAR_06750: Uncharacterized protein involved in iron uptake |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -59 score = 4.86504 sequence = CAATAAGAATGATTATCACCT Gene: VPA0157: Uncharacterized protein involved in iron uptake |
|
*
Vibrio splendidus LGP32 Site: position = -57 score = 4.84533 sequence = CAATACGAATTATTATCAACT Gene: VS_II0685: Uncharacterized protein involved in iron uptake |
|
*
Vibrio salmonicida LFI1238 Site: position = -61 score = 4.69492 sequence = CAACGCAAATCATTATCAATT Gene: VSAL_II0118: Uncharacterized protein involved in iron uptake |
*
Vibrio angustum S14 Site: position = -61 score = 5.2234 sequence = CAATAAGAACGATTATCAATT Gene: VAS14_12444: Uncharacterized protein involved in iron uptake |
*
Photobacterium profundum SS9 Site: position = -87 score = 5.27092 sequence = CAATGAAAACGATTATCAATT Gene: PBPRB1213: Uncharacterized protein involved in iron uptake |
Uncharacterized protein involved in iron uptake |
| PF10029 |
|
|
Gene: VIBHAR_06749: Predicted periplasmic protein (DUF2271) |
Gene: VPA0158: Predicted periplasmic protein (DUF2271) |
|
Gene: VS_II0686: Predicted periplasmic protein (DUF2271) |
|
Gene: VSAL_II0119: Predicted periplasmic protein (DUF2271) |
Gene: VAS14_12439: Predicted periplasmic protein (DUF2271) |
Gene: PBPRB1212: Predicted periplasmic protein (DUF2271) |
Predicted periplasmic protein (DUF2271) |
| cbiM |
|
|
Gene: VIBHAR_06748: ABC-type Co2+ transport system, periplasmic component |
Gene: VPA0159: ABC-type Co2+ transport system, periplasmic component |
|
Gene: VS_II0687: ABC-type Co2+ transport system, periplasmic component |
|
Gene: VSAL_II0120: ABC-type Co2+ transport system, periplasmic component |
Gene: VAS14_12434: ABC-type Co2+ transport system, periplasmic component |
Gene: PBPRB1211: ABC-type Co2+ transport system, periplasmic component |
ABC-type Co2+ transport system, periplasmic component |
| VIBHAR_06747 |
|
|
Gene: VIBHAR_06747: conserved hypothetical protein |
Gene: VPA0160: conserved hypothetical protein |
|
Gene: VS_II0688: conserved hypothetical protein |
|
Gene: VSAL_II0121: conserved hypothetical protein |
Gene: VAS14_12429: conserved hypothetical protein |
Gene: PBPRB1210: conserved hypothetical protein |
conserved hypothetical protein |
| VIBHAR_06746 |
|
|
Gene: VIBHAR_06746: conserved hypothetical protein |
Gene: VPA0161: conserved hypothetical protein |
|
Gene: VS_II0689: conserved hypothetical protein |
|
Gene: VSAL_II0122: conserved hypothetical protein |
Gene: VAS14_12424: conserved hypothetical protein |
Gene: PBPRB1209: conserved hypothetical protein |
conserved hypothetical protein |
| PF01297 |
|
|
Gene: VIBHAR_06745: ABC transporter, metal-binding lipoprotein |
Gene: VPA0162: ABC transporter, metal-binding lipoprotein |
|
Gene: VS_II0690: ABC transporter, metal-binding lipoprotein |
|
Gene: VSAL_II0123: ABC transporter, metal-binding lipoprotein |
Gene: VAS14_12419: ABC transporter, metal-binding lipoprotein |
Gene: PBPRB1208: ABC transporter, metal-binding lipoprotein |
ABC transporter, metal-binding lipoprotein |
| COG1121 |
|
|
Gene: VIBHAR_06744: ABC-type Mn/Zn transport systems, ATPase component |
Gene: VPA0163: ABC-type Mn/Zn transport systems, ATPase component |
|
Gene: VS_II0691: ABC-type Mn/Zn transport systems, ATPase component |
|
Gene: VSAL_II0124: ABC-type Mn/Zn transport systems, ATPase component |
Gene: VAS14_12414: ABC-type Mn/Zn transport systems, ATPase component |
Gene: PBPRB1207: ABC-type Mn/Zn transport systems, ATPase component |
ABC-type Mn/Zn transport systems, ATPase component |
| COG1108 |
|
|
Gene: VIBHAR_06743: ABC-type Mn2+/Zn2+ transport systems, permease components |
Gene: VPA0164: ABC-type Mn2+/Zn2+ transport systems, permease components |
|
Gene: VS_II0692: ABC-type Mn2+/Zn2+ transport systems, permease components |
|
Gene: VSAL_II0125: ABC-type Mn2+/Zn2+ transport systems, permease components |
Gene: VAS14_12409: ABC-type Mn2+/Zn2+ transport systems, permease components |
Gene: PBPRB1206: ABC-type Mn2+/Zn2+ transport systems, permease components |
ABC-type Mn2+/Zn2+ transport systems, permease components |
| COG0803 |
|
|
Gene: VIBHAR_06742: ABC-type metal ion transport system, periplasmic component/surface adhesin |
Gene: VPA0165: ABC-type metal ion transport system, periplasmic component/surface adhesin |
|
Gene: VS_II0693: ABC-type metal ion transport system, periplasmic component/surface adhesin |
|
Gene: VSAL_II0126: ABC-type metal ion transport system, periplasmic component/surface adhesin |
Gene: VAS14_12404: ABC-type metal ion transport system, periplasmic component/surface adhesin |
Gene: PBPRB1205: ABC-type metal ion transport system, periplasmic component/surface adhesin |
ABC-type metal ion transport system, periplasmic component/surface adhesin |
| CRON 16. | |||||||||||
| COG2132 |
|
*
Vibrio vulnificus CMCP6 Site: position = -183 score = 5.20449 sequence = TGTTGAGAATGATTATTAATA Gene: VV1_0966: Multicopper oxidase |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -65 score = 5.42212 sequence = AACTGAGAATCATTATTAATA Gene: VIBHAR_00368: Multicopper oxidase |
|
*
Vibrio shilonii AK1 Site: position = -44 score = 4.83638 sequence = AATTGAGAATCATTATCTAAT Gene: VSAK1_24319: Multicopper oxidase |
*
Vibrio splendidus LGP32 Site: position = -62 score = 5.39285 sequence = TTATGAGAATTATTCTCAATA Gene: VS_3101: Multicopper oxidase |
|
|
|
|
Multicopper oxidase |
| CRON 17. | |||||||||||
| nrfA |
|
Gene: VV1_3035: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit |
Gene: VIBHAR_02727: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit |
Gene: VP1929: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit |
*
Vibrio shilonii AK1 Site: position = -241 score = 5.71943 sequence = AAATGATAATTAATATCATCA Gene: VSAK1_05600: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit |
*
Vibrio splendidus LGP32 Site: position = -281 score = 5.40717 sequence = ATATGATAATAATTCTCAGTT Gene: VS_1933: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit |
*
Vibrio fischeri ES114 Site: position = -226 score = 5.5546 sequence = AAATAAGAATCATTCTTAATA Gene: VF_1554: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit |
*
Vibrio salmonicida LFI1238 Site: position = -227 score = 5.4635 sequence = AAATAAGAACCATTATTAATA Gene: VSAL_I1997: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit |
|
Gene: PBPRA1258: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit |
Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit |
| CRON 18. | |||||||||||
| sodA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -37 score = 6.01719 sequence = TAATGATATTAATTATCATTA Gene: VC2694: Manganese superoxide dismutase (EC 1.15.1.1) |
*
Vibrio vulnificus CMCP6 Site: position = -58 score = 5.55134 sequence = AGTTGATAATGGTTATCATTA Gene: VV1_1252: Manganese superoxide dismutase (EC 1.15.1.1) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -51 score = 4.75251 sequence = TAATGATTTTCATTAACATTA Site: position = -57 score = 5.49732 sequence = AGTTGATAATGATTTTCATTA Gene: VIBHAR_00151: Manganese superoxide dismutase (EC 1.15.1.1) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -58 score = 4.9832 sequence = AGTTGATAATGACTTTCATTA Gene: VP2860: Manganese superoxide dismutase (EC 1.15.1.1) |
|
*
Vibrio splendidus LGP32 Site: position = -58 score = 5.13115 sequence = AGTTGATAATGATTTCCATTA Site: position = -52 score = 5.17159 sequence = TAATGATTTCCATTATCATTA Gene: VS_2918: Manganese superoxide dismutase (EC 1.15.1.1) |
|
|
*
Vibrio angustum S14 Site: position = -55 score = 6.09746 sequence = TAATGATAATAGTTATCATTA Gene: VAS14_05603: Manganese superoxide dismutase (EC 1.15.1.1) |
*
Photobacterium profundum SS9 Site: position = -54 score = 5.40553 sequence = TAATGCGAGTAATTATCATTA Gene: PBPRA2569: Manganese superoxide dismutase (EC 1.15.1.1) |
Manganese superoxide dismutase (EC 1.15.1.1) |
| PF10952 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -53 score = 5.83701 sequence = ACATGATAATAATTATCAATT Gene: VC1009: Protein of unknown function (DUF2753) |
*
Vibrio vulnificus CMCP6 Site: position = -56 score = 5.74859 sequence = ACATGATAATAATTTTCATTT Gene: VV1_3101: Protein of unknown function (DUF2753) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -58 score = 5.34437 sequence = ACTTGATAATAATTATCGTTT Gene: VIBHAR_02989: Protein of unknown function (DUF2753) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -57 score = 5.34437 sequence = ACTTGATAATAATTATCGTTT Gene: VP2110: Protein of unknown function (DUF2753) |
*
Vibrio shilonii AK1 Site: position = -148 score = 4.99466 sequence = AAATGATAATCGTTATCGAAT Site: position = -55 score = 5.71637 sequence = AAATGATAATCAATATCATCT Gene: VSAK1_20819: Protein of unknown function (DUF2753) |
*
Vibrio splendidus LGP32 Site: position = -56 score = 5.98817 sequence = ACATGATAATAATTATCATTT Site: position = -105 score = 4.37369 sequence = AATCGATATTCTTTACTAATT Site: position = -112 score = 4.60763 sequence = TATTAATAATCGATATTCTTT Gene: VS_0969: Protein of unknown function (DUF2753) |
*
Vibrio fischeri ES114 Site: position = -70 score = 5.8061 sequence = AATTGATAATAATTCTCAGTT Gene: VF_0927: Protein of unknown function (DUF2753) |
*
Vibrio salmonicida LFI1238 Site: position = -61 score = 6.13153 sequence = TAATGATAATAATTCTCAATT Gene: VSAL_I1864: Protein of unknown function (DUF2753) |
Gene: VAS14_05608: Protein of unknown function (DUF2753) |
Gene: PBPRA2570: Protein of unknown function (DUF2753) |
Protein of unknown function (DUF2753) |
| CRON 19. | |||||||||||
| VSAK1_04950 |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -108 score = 5.84242 sequence = AAATGATAATAAATAGCATTA Gene: VSAK1_04950: TonB-dependent siderophore receptor |
|
|
|
*
Vibrio angustum S14 Site: position = -27 score = 5.6407 sequence = AAATGATAATTCATCTCATTT Gene: VAS14_12284: TonB-dependent siderophore receptor |
|
TonB-dependent siderophore receptor |
| CRON 20. | |||||||||||
| VIBHAR_03036 |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -41 score = 5.73806 sequence = AATTGATAATGATTTTCAATA Site: position = -35 score = 5.0343 sequence = TAATGATTTTCAATATCAATT Gene: VIBHAR_03036: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| PF00106 |
|
|
Gene: VIBHAR_03037: Short chain dehydrogenase |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -204 score = 5.88922 sequence = AATTGATAATGATTTTCATTA Gene: VP2146: Short chain dehydrogenase |
Gene: VSAK1_03509: Short chain dehydrogenase |
*
Vibrio splendidus LGP32 Site: position = -197 score = 6.09746 sequence = TAATGATAATAGTTATCATTA Gene: VS_0942: Short chain dehydrogenase |
Gene: VF_1658: Short chain dehydrogenase |
|
*
Vibrio angustum S14 Site: position = -128 score = 6.07483 sequence = AATTGATAATTATTATCAATA Gene: VAS14_10544: Short chain dehydrogenase |
|
Short chain dehydrogenase |
| CRON 21. | |||||||||||
| hutA |
|
Gene: VV20276: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -81 score = 5.20837 sequence = GAATGATAGTAATTACCATTT Gene: VIBHAR_05789: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
|
|
|
|
|
|
|
TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
| CRON 22. | |||||||||||
| fhuA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -54 score = 5.23312 sequence = AATTGAGAAAGATTCGCAATT Site: position = -24 score = 4.49305 sequence = TAATTAAGATAATTATCACTA Gene: VC0200: TonB-dependent outer membrane receptor for iron siderophores |
*
Vibrio vulnificus CMCP6 Site: position = -47 score = 5.40242 sequence = AAATGAGAATTACTACCATTA Gene: VV21337: TonB-dependent outer membrane receptor for iron siderophores |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -48 score = 5.55221 sequence = AAATGAGATTTATTACTATTT Gene: VIBHAR_06299: TonB-dependent outer membrane receptor for iron siderophores |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -57 score = 5.45153 sequence = AAATGATAATAATTACAATTA Gene: VPA1435: TonB-dependent outer membrane receptor for iron siderophores |
|
*
Vibrio splendidus LGP32 Site: position = -49 score = 5.55221 sequence = AAATGAGATTTATTACTATTT Gene: VS_II0501: TonB-dependent outer membrane receptor for iron siderophores |
*
Vibrio fischeri ES114 Site: position = -55 score = 4.72857 sequence = GCAAGAGAATCATTCTCATTT Gene: VF_A0784: TonB-dependent outer membrane receptor for iron siderophores |
*
Vibrio salmonicida LFI1238 Site: position = -56 score = 4.72857 sequence = GCAAGAGAATCATTCTCATTT Gene: VSAL_II0909: TonB-dependent outer membrane receptor for iron siderophores |
|
*
Photobacterium profundum SS9 Site: position = -138 score = 4.71786 sequence = CAATGATAGTAGTTATCATTG Gene: PBPRA1566: TonB-dependent outer membrane receptor for iron siderophores |
TonB-dependent outer membrane receptor for iron siderophores |
| fhuC |
Gene: VC0201: Ferrichrome transport ATP-binding protein FhuC |
|
Gene: VIBHAR_06304: Ferrichrome transport ATP-binding protein FhuC |
Gene: VPA1436: Ferrichrome transport ATP-binding protein FhuC |
|
Gene: VS_II0498: Ferrichrome transport ATP-binding protein FhuC |
Gene: VF_A0783: Ferrichrome transport ATP-binding protein FhuC |
Gene: VSAL_II0908: Ferrichrome transport ATP-binding protein FhuC |
|
Gene: PBPRA1565: Ferrichrome transport ATP-binding protein FhuC |
Ferrichrome transport ATP-binding protein FhuC |
| fhuD |
Gene: VC0202: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) |
|
Gene: VIBHAR_06298: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) |
Gene: VPA1437: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) |
|
Gene: VS_II0502: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) |
Gene: VF_A0782: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) |
|
|
Gene: PBPRA1564: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) |
Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) |
| fhuB |
Gene: VC0203: Ferrichrome transport system permease protein FhuB |
|
Gene: VIBHAR_06297: Ferrichrome transport system permease protein FhuB |
Gene: VPA1438: Ferrichrome transport system permease protein FhuB |
|
Gene: VS_II0503: Ferrichrome transport system permease protein FhuB |
|
|
|
Gene: PBPRA1563: Ferrichrome transport system permease protein FhuB |
Ferrichrome transport system permease protein FhuB |
| CRON 23. | |||||||||||
| VSAK1_14737 |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -108 score = 4.59226 sequence = AGATGAAAATAATTGCCACTA Site: position = -77 score = 5.40116 sequence = AAATGATAGTAATTCGTATTT Gene: VSAK1_14737: TonB-dependent hemin , ferrichrome receptor |
|
|
|
*
Vibrio angustum S14 Site: position = -80 score = 5.46454 sequence = AAATGATAGTAATTATCGTTT Gene: VAS14_03678: TonB-dependent hemin , ferrichrome receptor |
|
TonB-dependent hemin , ferrichrome receptor |
| VCA0575 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -178 score = 5.67749 sequence = TAATGATAATTGCTATCATTT Gene: VCA0575: Transcriptional regulator, LysR family |
*
Vibrio vulnificus CMCP6 Site: position = -145 score = 5.48039 sequence = TAATGATAATTACTATCATTC Gene: VV20277: Transcriptional regulator, LysR family |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -173 score = 5.20837 sequence = AAATGGTAATTACTATCATTC Gene: VIBHAR_05788: Transcriptional regulator, LysR family |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -189 score = 4.41889 sequence = AAATGTTAATGGATCTAAATA Site: position = -173 score = 5.67039 sequence = AAATAATAATTACTATCATTA Site: position = -167 score = 4.67356 sequence = TAATTACTATCATTATCATTT Gene: VPA0883: Transcriptional regulator, LysR family |
Gene: VSAK1_14742: Transcriptional regulator, LysR family |
Gene: VS_II0749: Transcriptional regulator, LysR family |
|
|
Gene: VAS14_12529: Transcriptional regulator, LysR family |
Gene: PBPRB0921: Transcriptional regulator, LysR family |
Transcriptional regulator, LysR family |
| CRON 24. | |||||||||||
| PBPRB1034 |
|
|
|
|
|
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -141 score = 4.92052 sequence = TAATACAAATAATAATTATTT Site: position = -135 score = 5.94493 sequence = AAATAATAATTATTTTCATTA Gene: PBPRB1034: hypothetical protein |
hypothetical protein |
| PBPRB1033 |
|
|
|
|
|
|
|
|
|
Gene: PBPRB1033: hypothetical protein |
hypothetical protein |
| PBPRB1032 |
|
|
|
|
|
|
|
|
|
Gene: PBPRB1032: High-affinity iron permease |
High-affinity iron permease |
| PBPRB1031 |
|
|
|
|
|
|
|
|
|
Gene: PBPRB1031: BarJ |
BarJ |
| PBPRB1030 |
|
|
|
|
|
|
|
|
|
Gene: PBPRB1030: hypothetical protein |
hypothetical protein |
| PBPRB1029 |
|
|
|
|
|
|
|
|
|
Gene: PBPRB1029: hypothetical protein |
hypothetical protein |
| CRON 25. | |||||||||||
| fepB |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -95 score = 4.97582 sequence = TATTGATATTACTTCTCAGTT Gene: VIBHAR_06007: ABC-type Fe3+-siderophores transport systems, periplasmic component |
|
*
Vibrio shilonii AK1 Site: position = -76 score = 4.43217 sequence = TAATAGTATTGATAACCATTA Site: position = -70 score = 5.25796 sequence = TATTGATAACCATTATTGTTT Gene: VSAK1_22029: ABC-type Fe3+-siderophores transport systems, periplasmic component |
|
|
|
|
|
ABC-type Fe3+-siderophores transport systems, periplasmic component |
| fepD |
|
|
2
Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06009: ABC-type Fe3+-siderophore transport system, permease component Gene: VIBHAR_06008: ABC-type Fe3+-siderophore transport system, permease component |
|
2
Vibrio shilonii AK1 Gene: VSAK1_22024: ABC-type Fe3+-siderophore transport system, permease component Gene: VSAK1_22019: ABC-type Fe3+-siderophore transport system, permease component |
|
|
|
|
|
ABC-type Fe3+-siderophore transport system, permease component |
| fepC |
|
|
Gene: VIBHAR_06010: ABC-type Fe3+-siderophores transport system, ATPase component |
|
Gene: VSAK1_22014: ABC-type Fe3+-siderophores transport system, ATPase component |
|
|
|
|
|
ABC-type Fe3+-siderophores transport system, ATPase component |
| fepA |
|
|
Gene: VIBHAR_06011: TonB-dependent ferric achromobactin receptor |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -60 score = 5.54018 sequence = AAATAATATTTGTTCTTATTT Gene: VPA1657: TonB-dependent ferric achromobactin receptor |
*
Vibrio shilonii AK1 Site: position = -69 score = 5.24505 sequence = TATTGATAACTATTATCAAAA Gene: VSAK1_22009: TonB-dependent ferric achromobactin receptor |
*
Vibrio splendidus LGP32 Site: position = -60 score = 5.35018 sequence = AAATGATATTTGTTCTTATTC Gene: VS_II1128: TonB-dependent ferric achromobactin receptor |
|
|
*
Vibrio angustum S14 Site: position = -70 score = 5.56549 sequence = AAGTGATAATTATTTGCATTA Gene: VAS14_15544: TonB-dependent ferric achromobactin receptor |
|
TonB-dependent ferric achromobactin receptor |
| CRON 26. | |||||||||||
| iucA |
|
|
|
|
|
|
*
Vibrio fischeri ES114 Site: position = -52 score = 5.53394 sequence = TAATGAGAATCATTAGCATTC Gene: VF_A0161: aerobactin siderophore biosynthesis protein IucA |
|
|
|
aerobactin siderophore biosynthesis protein IucA |
| iucB |
|
|
|
|
|
|
Gene: VF_A0162: aerobactin siderophore synthesis protein IucB |
|
|
|
N(6)-hydroxylysine O-acetyltransferase |
| iucC |
|
|
|
|
|
|
Gene: VF_A0163: aerobactin siderophore biosynthesis protein IucC |
|
|
|
siderophore biosynthesis IucC protein |
| iucD |
|
|
|
|
|
|
Gene: VF_A0164: aerobactin siderophore biosynthesis protein IucD |
|
|
|
L-lysine 6-monooxygenase |
| iutA |
|
*
Vibrio vulnificus CMCP6 Site: position = -145 score = 5.2775 sequence = AAAAGAAAATAATTCGCATTT Site: position = -97 score = 5.27911 sequence = CAATAATAACAATTCTTATTT Gene: VV21016: Aerobactin siderophore receptor IutA,TonB-dependent |
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -55 score = 5.08835 sequence = TATTGATAATAAGTATCATTG Gene: VPA0979: Aerobactin siderophore receptor IutA,TonB-dependent |
*
Vibrio shilonii AK1 Site: position = -112 score = 5.91248 sequence = AAATAGTAATAATTATCATTT Gene: VSAK1_20974: Aerobactin siderophore receptor IutA,TonB-dependent |
*
Vibrio splendidus LGP32 Site: position = -298 score = 5.36747 sequence = CAATAATAATGATTCTTATTT Site: position = -263 score = 4.55501 sequence = TAACGATAATACTTCGTACTT Gene: VS_2116: Aerobactin siderophore receptor IutA,TonB-dependent |
*
Vibrio fischeri ES114 Site: position = -62 score = 4.46405 sequence = GAATACGGATTTTTATCATTT Gene: VF_A0165: Aerobactin siderophore receptor IutA,TonB-dependent |
Gene: VSAL_II0279: Aerobactin siderophore receptor IutA,TonB-dependent |
|
|
Aerobactin siderophore receptor IutA,TonB-dependent |
| CRON 27. | |||||||||||
| VV20839 |
|
*
Vibrio vulnificus CMCP6 Site: position = -133 score = 5.53886 sequence = TAATGATATACATTCTCATTT Gene: VV20839: Isochorismate pyruvate-lyase of siderophore biosynthesis # Vulnibactin-specific |
|
|
|
|
|
|
|
|
Isochorismate pyruvate-lyase of siderophore biosynthesis # Vulnibactin-specific |
| VC0771 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -167 score = 6.09309 sequence = AAATGATAATTGTTATTATTT Gene: VC0771: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB |
Gene: VV20838: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB |
Gene: VIBHAR_02097: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB |
|
|
|
|
|
|
|
Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB |
| viuB |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -140 score = 5.53886 sequence = TAATGATATACATTCTCATTT Gene: VC2210: Vibriobactin utilization protein ViuB |
Gene: VV20837: Vibriobactin utilization protein ViuB |
|
|
|
Gene: VS_1122: Vibriobactin utilization protein ViuB |
|
|
|
*
Photobacterium profundum SS9 Site: position = -45 score = 5.85483 sequence = AAATGATAATGGTTTTCATTA Gene: PBPRB1812: Vibriobactin utilization protein ViuB |
Vibriobactin utilization protein ViuB |
| CRON 28. | |||||||||||
| vibF |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -90 score = 4.36914 sequence = TGATAATGATTATTATTAACT Site: position = -93 score = 5.93615 sequence = AATTGATAATGATTATTATTA Gene: VC2209: nonribosomal peptide synthetase VibF |
*
Vibrio vulnificus CMCP6 Site: position = -8 score = 6.08731 sequence = AAATGATAATGATTATTATTA Site: position = -176 score = 5.79037 sequence = TAATGATAATTATTATCGTTA Site: position = -182 score = 4.82569 sequence = TAATGTTAATGATAATTATTA Gene: VV20831: nonribosomal peptide synthetase VibF |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -63 score = 4.41901 sequence = AAATGATTATTGTTTGCAAAA Site: position = -69 score = 4.59931 sequence = TATTGTAAATGATTATTGTTT Gene: VIBHAR_02101: nonribosomal peptide synthetase VibF |
|
|
|
|
|
|
|
nonribosomal peptide synthetase VibF |
| VV20830 |
|
Gene: VV20830: Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -111 score = 5.06617 sequence = AAATGATAATTAATCCTATCA Gene: VIBHAR_02109: Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific |
|
|
|
|
|
|
|
Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific |
| CRON 29. | |||||||||||
| VC0426 |
Gene: VC0426: Predicted membrane protein |
Gene: VV1_1471: Predicted membrane protein |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -60 score = 6.0374 sequence = TAATGATAATAATTCTCAATA Gene: VIBHAR_03638: Predicted membrane protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -58 score = 5.07444 sequence = TAATGAGAAGTATTATCGATA Gene: VP2647: Predicted membrane protein |
*
Vibrio shilonii AK1 Site: position = -70 score = 4.92022 sequence = GATTGATTTTAATTCTCATTA Gene: VSAK1_10253: Predicted membrane protein |
Gene: VS_2734: Predicted membrane protein |
|
|
Gene: VAS14_07930: Predicted membrane protein |
Gene: PBPRA0482: Predicted membrane protein |
Predicted membrane protein |
| CRON 30. | |||||||||||
| VCA0743 |
Gene: VCA0743: uroporphyrinogen decarboxylase |
*
Vibrio vulnificus CMCP6 Site: position = -336 score = 5.06362 sequence = TATCAATAATAATTCTCATTC Gene: VV20115: uroporphyrinogen decarboxylase |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -305 score = 4.42882 sequence = TAATAATTCTCATTTTCAATA Site: position = -311 score = 6.03303 sequence = AATTAATAATAATTCTCATTT Gene: VIBHAR_06129: uroporphyrinogen decarboxylase |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -216 score = 4.44711 sequence = TAATAAGTAAAGTTATCAGTA Gene: VPA0666: uroporphyrinogen decarboxylase |
Gene: VSAK1_15002: uroporphyrinogen decarboxylase |
*
Vibrio splendidus LGP32 Site: position = -251 score = 4.99031 sequence = ATACAAGAATAATTATCAATT Gene: VS_II0548: uroporphyrinogen decarboxylase |
|
|
|
|
uroporphyrinogen decarboxylase |
| CRON 31. | |||||||||||
| irgA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -34 score = 6.03303 sequence = AATTAAGAATAATTATCATTT Gene: VC0475: TonB-dependent receptor; Enterobactin receptor IrgA |
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -33 score = 6.03029 sequence = AAATAATAATCATTATCAATT Gene: VP2602: TonB-dependent receptor; Enterobactin receptor IrgA |
|
|
|
|
|
|
TonB-dependent receptor; Enterobactin receptor IrgA |
| CRON 32. | |||||||||||
| VV21506 |
|
*
Vibrio vulnificus CMCP6 Site: position = -79 score = 5.86266 sequence = AATTGATATTCATTCTCATTT Gene: VV21506: hypothetical protein |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -48 score = 4.89099 sequence = AATTGATATACATTCTCTTTT Gene: VIBHAR_06888: hypothetical protein |
|
|
|
|
*
Vibrio salmonicida LFI1238 Site: position = -50 score = 5.39348 sequence = AATTGATATAAGTTCTCATTT Gene: VSAL_I0884: hypothetical protein |
|
|
hypothetical protein |
| CRON 33. | |||||||||||
| fbpA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 4 score = 5.17978 sequence = GATTGATAAAGGTTATCATTA Gene: VC0608: Ferric iron ABC transporter, iron-binding protein |
*2
Vibrio vulnificus CMCP6 Gene: VV1_1661: Ferric iron ABC transporter, iron-binding protein Site: position = -42 score = 5.19986 sequence = TACTGATAAACGTTATCATTA Gene: VV1_1660: Ferric iron ABC transporter, iron-binding protein |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -41 score = 5.294 sequence = AACTGATAAACGTTATCATTA Gene: VIBHAR_03435: Ferric iron ABC transporter, iron-binding protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -40 score = 5.294 sequence = AACTGATAAACGTTATCATTA Gene: VP2491: Ferric iron ABC transporter, iron-binding protein |
Gene: VSAK1_08024: Ferric iron ABC transporter, iron-binding protein |
*
Vibrio splendidus LGP32 Site: position = -41 score = 5.05958 sequence = AACTGATAGACATTATCATTT Gene: VS_2518: Ferric iron ABC transporter, iron-binding protein |
*
Vibrio fischeri ES114 Site: position = -53 score = 5.93921 sequence = TATTGATAATTATTATTATTA Site: position = -47 score = 4.88867 sequence = TAATTATTATTATTACCATTT Gene: VF_2151: Ferric iron ABC transporter, iron-binding protein |
*
Vibrio salmonicida LFI1238 Site: position = -53 score = 5.37443 sequence = TATTGATAAGTATTCTTATTA Gene: VSAL_I2588: Ferric iron ABC transporter, iron-binding protein |
*
Vibrio angustum S14 Site: position = -46 score = 5.55937 sequence = TATTGAGAAACATTATCATTA Gene: VAS14_20031: Ferric iron ABC transporter, iron-binding protein |
*
Photobacterium profundum SS9 Site: position = -2 score = 5.51356 sequence = TATTGATAATTGTTATCATTG Gene: PBPRA3184: Ferric iron ABC transporter, iron-binding protein |
Ferric iron ABC transporter, iron-binding protein |
| fbpB |
Gene: VC0609: Ferric iron ABC transporter, permease protein |
Gene: VV1_1662: Ferric iron ABC transporter, permease protein |
Gene: VIBHAR_03434: Ferric iron ABC transporter, permease protein |
Gene: VP2490: Ferric iron ABC transporter, permease protein |
Gene: VSAK1_08029: Ferric iron ABC transporter, permease protein |
Gene: VS_2517: Ferric iron ABC transporter, permease protein |
Gene: VF_2150: Ferric iron ABC transporter, permease protein |
Gene: VSAL_I2587: Ferric iron ABC transporter, permease protein |
Gene: VAS14_20036: Ferric iron ABC transporter, permease protein |
Gene: PBPRA3183: Ferric iron ABC transporter, permease protein |
Ferric iron ABC transporter, permease protein |
| fbpC |
Gene: VC0610: Ferric iron ABC transporter, ATP-binding protein |
Gene: VV1_1663: Ferric iron ABC transporter, ATP-binding protein |
Gene: VIBHAR_03433: Ferric iron ABC transporter, ATP-binding protein |
Gene: VP2489: Ferric iron ABC transporter, ATP-binding protein |
Gene: VSAK1_08034: Ferric iron ABC transporter, ATP-binding protein |
Gene: VS_2516: Ferric iron ABC transporter, ATP-binding protein |
Gene: VF_2149: Ferric iron ABC transporter, ATP-binding protein |
Gene: VSAL_I2586: Ferric iron ABC transporter, ATP-binding protein |
Gene: VAS14_20041: Ferric iron ABC transporter, ATP-binding protein |
Gene: PBPRA3182: Ferric iron ABC transporter, ATP-binding protein |
Ferric iron ABC transporter, ATP-binding protein |
| CRON 34. | |||||||||||
| VV20793 |
|
*
Vibrio vulnificus CMCP6 Site: position = -95 score = 4.80205 sequence = AAATGATATAAACTTGCATTT Site: position = -78 score = 5.53046 sequence = ATTTGATAATAATTTTCATTT Gene: VV20793: Conserved hypothetical protein |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -50 score = 5.81474 sequence = AATTGATAATTAATTTCATTT Site: position = -73 score = 4.76887 sequence = AAATGAAAACAAGTCGCACTT Gene: VIBHAR_05095: Conserved hypothetical protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -57 score = 5.71754 sequence = AATTGATAATCAATTTCATTT Site: position = -80 score = 4.81677 sequence = AAATGAAAACAATACGCACTT Gene: VPA1494: Conserved hypothetical protein |
*2
Vibrio shilonii AK1 Site: position = -40 score = 5.54582 sequence = AAATGATATTTATTTGCAATT Site: position = -23 score = 4.63802 sequence = AATTGATTCTAATTTGCATTT Gene: VSAK1_06125: Conserved hypothetical protein Site: position = -73 score = 5.06605 sequence = AAATGATAATTACTTGCATTC Gene: VSAK1_17632: Conserved hypothetical protein |
*
Vibrio splendidus LGP32 Site: position = -72 score = 4.60032 sequence = GAATGATTTTAATTTGCAATT Site: position = -55 score = 5.96017 sequence = AATTGATAATAAATATCATTA Site: position = -49 score = 4.68025 sequence = TAATAAATATCATTAACATTT Gene: VS_II1376: Conserved hypothetical protein |
|
|
|
*
Photobacterium profundum SS9 Site: position = -54 score = 5.86297 sequence = AATTGATAATGAATATCATTA Gene: PBPRB1172: Conserved hypothetical protein |
Conserved hypothetical protein |
| VV20794 |
|
Gene: VV20794: ABC transporter, ATP-binding protein |
Gene: VIBHAR_05094: ABC transporter, ATP-binding protein |
Gene: VPA1495: ABC transporter, ATP-binding protein |
Gene: VSAK1_17627: ABC transporter, ATP-binding protein |
Gene: VS_II1377: ABC transporter, ATP-binding protein |
|
|
|
Gene: PBPRB1173: ABC transporter, ATP-binding protein |
ABC transporter, ATP-binding protein |
| CRON 35. | |||||||||||
| VCA1041 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -61 score = 5.16447 sequence = TTTTGAGAATAAATATCAATT Gene: VCA1041: Phosphomannomutase |
*
Vibrio vulnificus CMCP6 Site: position = -57 score = 6.20547 sequence = AAATGATATTTATTATCATTT Gene: VV20569: Phosphomannomutase |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -93 score = 4.57184 sequence = AATTGAGAACCATTTACATTG Gene: VIBHAR_06273: Phosphomannomutase |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -99 score = 5.00459 sequence = AATTGAGAACCATTTACATTA Gene: VPA0535: Phosphomannomutase |
*
Vibrio shilonii AK1 Site: position = -98 score = 4.35644 sequence = TAATGATATTGAGAGTCATTT Gene: VSAK1_17622: Phosphomannomutase |
*
Vibrio splendidus LGP32 Site: position = -63 score = 5.76333 sequence = AAATGATAATCAGTATCATTT Gene: VS_II0364: Phosphomannomutase |
*
Vibrio fischeri ES114 Site: position = -59 score = 5.84211 sequence = AATTGATAATGTTTATCATTT Gene: VF_1056: Phosphomannomutase |
|
*
Vibrio angustum S14 Site: position = -123 score = 5.53576 sequence = TAATGCGAATGTTTATCATTT Gene: VAS14_13784: Phosphomannomutase |
*
Photobacterium profundum SS9 Site: position = -63 score = 5.65077 sequence = TAATGCGAATGAATATCATTT Gene: PBPRB0614: Phosphomannomutase |
Phosphomannomutase |
| CRON 36. | |||||||||||
| PF11449 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 1 score = 4.86436 sequence = TGTCGATAATAATTCTCATTC Site: position = -24 score = 5.1337 sequence = AATTGCGAATAGTTCTCAACT Gene: VC1688: Predicted manganese transporter, 11 TMS |
*
Vibrio vulnificus CMCP6 Site: position = -62 score = 5.46499 sequence = TATTGCGAATAATTCTCACTT Site: position = -36 score = 5.99285 sequence = TAATGATAATCATTCTTATTT Gene: VV1_2889: Predicted manganese transporter, 11 TMS |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -36 score = 5.91653 sequence = TAATGAGAATTATTACCATTT Site: position = -62 score = 5.46499 sequence = TATTGCGAATAATTCTCACTT Gene: VIBHAR_01859: Predicted manganese transporter, 11 TMS |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -30 score = 4.4636 sequence = TAATTATTACCATTTGCATTT Site: position = -62 score = 5.50235 sequence = TATTGCGAATAAATCTCATTT Site: position = -36 score = 6.01099 sequence = TAATGATAATTATTACCATTT Gene: VP1164: Predicted manganese transporter, 11 TMS |
*
Vibrio shilonii AK1 Site: position = -63 score = 5.05425 sequence = CATTGAGAATTATTCTCATAT Site: position = -37 score = 6.28269 sequence = TAATGATAATAATTCTCATTT Gene: VSAK1_04382: Predicted manganese transporter, 11 TMS |
*
Vibrio splendidus LGP32 Site: position = -61 score = 5.93749 sequence = AATTGATAATTATTATCATTC Site: position = -67 score = 4.3675 sequence = GAATGCAATTGATAATTATTA Gene: VS_2002: Predicted manganese transporter, 11 TMS |
*
Vibrio fischeri ES114 Site: position = -39 score = 5.30436 sequence = TACTAATAATCATTCGCATTT Site: position = -65 score = 5.83377 sequence = AGTTGATAATAATTCTCATTT Site: position = -72 score = 4.55738 sequence = AAATGATAGTTGATAATAATT Gene: VF_A0848: Predicted manganese transporter, 11 TMS |
*
Vibrio salmonicida LFI1238 Site: position = -39 score = 5.30436 sequence = TACTAATAATCATTCGCATTT Site: position = -72 score = 4.55738 sequence = AAATGATAGTTGATAATAATT Site: position = -65 score = 5.83377 sequence = AGTTGATAATAATTCTCATTT Gene: VSAL_II0074: Predicted manganese transporter, 11 TMS |
|
*
Photobacterium profundum SS9 Site: position = -77 score = 5.74255 sequence = ACTTGATAATAATTCTCATTT Site: position = -71 score = 4.4052 sequence = TAATAATTCTCATTTGCATTT Gene: PBPRB2013: Predicted manganese transporter, 11 TMS |
Predicted manganese transporter, 11 TMS |
| CRON 37. | |||||||||||
| VSAK1_03314 |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -102 score = 5.77725 sequence = AAATGATAATAGTTTGCATTT Gene: VSAK1_03314: putative transcriptional regulator, AraC/XylS family protein |
|
|
|
|
|
putative transcriptional regulator, AraC/XylS family protein |
| CRON 38. | |||||||||||
| pVSAL320_27 |
|
|
|
|
|
|
|
*
Vibrio salmonicida LFI1238 Site: position = -66 score = 5.72704 sequence = AAATGAGATTCATTATTATTA Gene: pVSAL320_27: putative periplasmic iron siderophore binding protein of ABC transporter |
|
|
putative periplasmic iron siderophore binding protein of ABC transporter |
| pVSAL320_28 |
|
|
|
|
|
|
|
Gene: pVSAL320_28: transport system permease protein |
|
|
transport system permease protein |
| pVSAL320_29 |
|
|
|
|
|
|
|
Gene: pVSAL320_29: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
|
|
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
| pVSAL320_30 |
|
|
|
|
|
|
|
Gene: pVSAL320_30: hypothetical protein |
|
|
hypothetical protein |
| CRON 39. | |||||||||||
| VC0773 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -114 score = 4.6574 sequence = AAATGGAAATTGCTTGCATTT Site: position = -91 score = 5.66493 sequence = TAATAAAAACTATTCTCATTT Gene: VC0773: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific |
*
Vibrio vulnificus CMCP6 Site: position = -264 score = 4.70318 sequence = TAATTATTATCGTTAGCATTT Site: position = -270 score = 5.79037 sequence = TAATGATAATTATTATCGTTA Gene: VV20835: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -50 score = 5.2635 sequence = AAATGAGAAGGGATCTCATTT Site: position = -113 score = 4.99009 sequence = GAGTGATAATTATTATCAAAA Site: position = -119 score = 4.55283 sequence = TAATGCGAGTGATAATTATTA Gene: VIBHAR_01398: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific |
|
|
|
|
|
|
Gene: PBPRB1824: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific |
Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific |
| VC0772 |
Gene: VC0772: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE |
Gene: VV20836: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE |
Gene: VIBHAR_01399: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE |
|
|
|
|
|
|
Gene: PBPRB1823: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE |
2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE |
| CRON 40. | |||||||||||
| mntH |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -66 score = 5.31875 sequence = AGGTGATATTGATTCTCATTT Gene: VIBHAR_04897: Manganese transport protein MntH |
|
*
Vibrio shilonii AK1 Site: position = -67 score = 5.35301 sequence = AGATGCGATTGATTATCATTT Gene: VSAK1_15507: Manganese transport protein MntH |
|
|
|
*
Vibrio angustum S14 Site: position = -61 score = 5.6242 sequence = AAATGACATTGATTATCATTT Gene: VAS14_12039: Manganese transport protein MntH |
|
Manganese transport protein MntH |
| CRON 41. | |||||||||||
| hutA |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -84 score = 5.54251 sequence = AAATAATAATACATATCATTT Gene: VSAK1_23799: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
Gene: VS_II0751: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
*
Vibrio fischeri ES114 Site: position = -69 score = 4.41997 sequence = TAGTAATTATCATTCGTAATA Site: position = -81 score = 4.43399 sequence = AAATGAAAATGATAGTAATTA Site: position = -75 score = 5.57453 sequence = AAATGATAGTAATTATCATTC Gene: VF_1234: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
|
|
*
Photobacterium profundum SS9 Site: position = -79 score = 5.27595 sequence = TAACGATAGTAATTCTCATTT Gene: PBPRA1535: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor |
| CRON 42. | |||||||||||
| VV21010 |
|
*
Vibrio vulnificus CMCP6 Site: position = -75 score = 5.06739 sequence = AAATGAGAATCAATTGTAATA Gene: VV21010: Hypothetical protein in aerobactin uptake cluster |
|
|
|
|
|
|
|
|
Hypothetical protein in aerobactin uptake cluster |
| fhuC |
|
*
Vibrio vulnificus CMCP6 Site: position = -81 score = 4.7806 sequence = TTATGAAAACAATTCTCATTG Gene: VV21011: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component |
|
|
Gene: VSAK1_20939: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component |
*
Vibrio splendidus LGP32 Site: position = -73 score = 4.39733 sequence = GAATAATTATCATTTTGATTT Site: position = -79 score = 4.72169 sequence = TTTAGCGAATAATTATCATTT Gene: VS_2112: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component |
*
Vibrio fischeri ES114 Site: position = -31 score = 5.56229 sequence = GAATAAAAATAATTATCATTA Site: position = -25 score = 5.01397 sequence = AAATAATTATCATTAACATTT Gene: VF_A0158: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component |
*
Vibrio salmonicida LFI1238 Site: position = -75 score = 4.56715 sequence = AAACAATTATCATTACTATTT Site: position = -81 score = 5.37674 sequence = GAATAAAAACAATTATCATTA Gene: VSAL_II0150: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component |
|
|
ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component |
| fhuD |
|
Gene: VV21012: ABC-type Fe3+-hydroxamate transport system, periplasmic component |
|
|
Gene: VSAK1_20944: ABC-type Fe3+-hydroxamate transport system, periplasmic component |
Gene: VS_2113: ABC-type Fe3+-hydroxamate transport system, periplasmic component |
Gene: VF_A0159: ABC-type Fe3+-hydroxamate transport system, periplasmic component |
Gene: VSAL_II0151: ABC-type Fe3+-hydroxamate transport system, periplasmic component |
|
|
ABC-type Fe3+-hydroxamate transport system, periplasmic component |
| fhuB |
|
Gene: VV21013: ABC-type Fe3+-siderophore transport system, permease component |
|
|
Gene: VSAK1_20949: ABC-type Fe3+-siderophore transport system, permease component |
Gene: VS_2114: ABC-type Fe3+-siderophore transport system, permease component |
Gene: VF_A0160: ABC-type Fe3+-siderophore transport system, permease component |
Gene: VSAL_II0152: ABC-type Fe3+-siderophore transport system, permease component |
|
|
ABC-type Fe3+-siderophore transport system, permease component |
| CRON 43. | |||||||||||
| bfd |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -54 score = 4.88758 sequence = AAATAAGAGTGATTCTCTTTT Gene: VC0364: Bacterioferritin-associated ferredoxin |
*
Vibrio vulnificus CMCP6 Site: position = -57 score = 5.53794 sequence = TAATGATAATGATTATCTATT Gene: VV1_1340: Bacterioferritin-associated ferredoxin |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -58 score = 4.53494 sequence = TAACAAGAACGATTCTTGTTT Gene: VIBHAR_00053: Bacterioferritin-associated ferredoxin |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -59 score = 4.36142 sequence = TAACAAGAACCATTCCCGTTT Gene: VP2769: Bacterioferritin-associated ferredoxin |
|
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -59 score = 5.09296 sequence = AAATGCAAACGATTCTCGTTT Gene: PBPRA0317: Bacterioferritin-associated ferredoxin |
Bacterioferritin-associated ferredoxin |
| bfr |
Gene: VC0365: Bacterioferritin |
Gene: VV1_1341: Bacterioferritin |
Gene: VIBHAR_00052: Bacterioferritin |
Gene: VP2768: Bacterioferritin |
|
|
|
|
|
Gene: PBPRA0318: Bacterioferritin |
Bacterioferritin |
| CRON 44. | |||||||||||
| torS |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -41 score = 5.35212 sequence = TAACGATAATTATTCTTAATA Gene: VCA0068: Methyl-accepting chemotaxis protein |
*
Vibrio vulnificus CMCP6 Site: position = -49 score = 5.20015 sequence = CAATAATATTCATTCTCATTA Gene: VV21555: Methyl-accepting chemotaxis protein |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -2 score = 5.33438 sequence = AAATGATAATAGTTATAATCT Gene: VIBHAR_05136: Methyl-accepting chemotaxis protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -40 score = 4.47896 sequence = TAATAATAATGATAATAATCA Gene: VPA1462: Methyl-accepting chemotaxis protein |
|
Gene: VS_II0204: Methyl-accepting chemotaxis protein |
|
|
|
|
Methyl-accepting chemotaxis protein |
| CRON 45. | |||||||||||
| PBPRB1816 |
|
|
|
|
|
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -121 score = 5.31972 sequence = GATTGATAACTATTTTTATTT Gene: PBPRB1816: Ferrichrome transport system permease protein FhuB (TC 3.A.1.14.3) |
Ferrichrome transport system permease protein FhuB (TC 3.A.1.14.3) |
| PBPRB1815 |
|
|
|
|
|
|
|
|
|
Gene: PBPRB1815: ABC-type Fe3+-siderophore transport system, permease component |
ABC-type Fe3+-siderophore transport system, permease component |
| VIBHAR_01766 |
|
|
Gene: VIBHAR_01766: Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3) |
|
|
|
|
|
|
Gene: PBPRB1814: Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3) |
Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3) |
| VIBHAR_01763 |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -29 score = 5.18994 sequence = AAATATCAATAATTATCATTT Gene: VIBHAR_01763: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1) |
|
|
|
|
|
|
|
Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1) |
| VIBHAR_01767 |
|
|
Gene: VIBHAR_01767: hypothetical protein |
|
|
|
Gene: VF_A0488: hypothetical protein |
*
Vibrio salmonicida LFI1238 Site: position = -30 score = 4.9911 sequence = AAATAAGAATAATTACTAAGT Gene: VSAL_II0573: hypothetical protein |
|
|
hypothetical protein |
| CRON 46. | |||||||||||
| VC1572 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -40 score = 5.61803 sequence = ATGTGATAATAATTATCATTT Gene: VC1572: hypothetical protein |
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -41 score = 6.13185 sequence = TATTGATAATAATTATCATTA Site: position = -38 score = 4.5203 sequence = TGATAATAATTATCATTATCT Gene: VIBHAR_00162: hypothetical protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -41 score = 6.22599 sequence = AATTGATAATAATTATCATTA Site: position = -38 score = 4.5203 sequence = TGATAATAATTATCATTATCT Gene: VP2872: hypothetical protein |
|
*
Vibrio splendidus LGP32 Site: position = -45 score = 5.6759 sequence = ATTTGATAATAATTATCATTA Site: position = -39 score = 4.53719 sequence = TAATAATTATCATTAACATTC Gene: VS_2936: hypothetical protein |
|
|
*
Vibrio angustum S14 Site: position = -98 score = 5.56567 sequence = AGATGATAATAATTATCAGTA Site: position = -92 score = 4.49362 sequence = TAATAATTATCAGTAGCAATT Site: position = -44 score = 5.60191 sequence = CAATGATAATGATTATCAATA Gene: VAS14_13589: hypothetical protein |
|
hypothetical protein |
| fumC |
Gene: VC1573: Fumarate hydratase class II (EC 4.2.1.2) |
|
Gene: VIBHAR_00163: Fumarate hydratase class II (EC 4.2.1.2) |
Gene: VP2873: Fumarate hydratase class II (EC 4.2.1.2) |
|
Gene: VS_2937: Fumarate hydratase class II (EC 4.2.1.2) |
|
|
Gene: VAS14_13594: Fumarate hydratase class II (EC 4.2.1.2) |
Gene: PBPRB0402: Fumarate hydratase class II (EC 4.2.1.2) |
Fumarate hydratase class II (EC 4.2.1.2) |
| CRON 47. | |||||||||||
| VV1_2646 |
|
*
Vibrio vulnificus CMCP6 Site: position = -23 score = 5.01868 sequence = AAATAGGACTTATTCTCATTA Gene: VV1_2646: ABC-type multidrug transport system, ATPase and permease component |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -24 score = 4.86752 sequence = TAATAGGACTTATTCTCAATT Gene: VIBHAR_02349: ABC-type multidrug transport system, ATPase and permease component |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -24 score = 4.96165 sequence = AAATAGGACTTATTCTCAATT Gene: VP1609: ABC-type multidrug transport system, ATPase and permease component |
*
Vibrio shilonii AK1 Site: position = -23 score = 4.6485 sequence = TAATAGGAACTATTCTCAAAA Gene: VSAK1_05315: ABC-type multidrug transport system, ATPase and permease component |
*
Vibrio splendidus LGP32 Site: position = -23 score = 5.01868 sequence = AAATAGGACTTATTCTCATTA Gene: VS_1414: ABC-type multidrug transport system, ATPase and permease component |
*
Vibrio fischeri ES114 Site: position = -26 score = 4.43344 sequence = AGATAATAATAGGAATCATTA Site: position = -20 score = 5.22938 sequence = TAATAGGAATCATTATCACTA Gene: VF_1277: ABC-type multidrug transport system, ATPase and permease component |
*
Vibrio salmonicida LFI1238 Site: position = -20 score = 5.00535 sequence = TAATAGGAATCATTCTCATTG Gene: VSAL_I1541: ABC-type multidrug transport system, ATPase and permease component |
*
Vibrio angustum S14 Site: position = -60 score = 4.72592 sequence = AAATGAAAACACTTAACAATA Site: position = -41 score = 4.79663 sequence = TAATAGGAATCATTATCACTG Gene: VAS14_02953: ABC-type multidrug transport system, ATPase and permease component |
Gene: PBPRA1924: ABC-type multidrug transport system, ATPase and permease component |
ABC-type multidrug transport system, ATPase and permease component |
| pqiA |
Gene: VC1500: Paraquat-inducible protein A |
Gene: VV1_2647: Paraquat-inducible protein A |
Gene: VIBHAR_02350: Paraquat-inducible protein A |
Gene: VP1610: Paraquat-inducible protein A |
Gene: VSAK1_05320: Paraquat-inducible protein A |
Gene: VS_1413: Paraquat-inducible protein A |
Gene: VF_1276: Paraquat-inducible protein A |
Gene: VSAL_I1540: Paraquat-inducible protein A |
Gene: VAS14_02958: Paraquat-inducible protein A |
Gene: PBPRA1925: Paraquat-inducible protein A |
Paraquat-inducible protein A |
| pqiB |
Gene: VC1501: Paraquat-inducible protein B |
Gene: VV1_2648: Paraquat-inducible protein B |
Gene: VIBHAR_02351: Paraquat-inducible protein B |
Gene: VP1611: Paraquat-inducible protein B |
Gene: VSAK1_05325: Paraquat-inducible protein B |
Gene: VS_1412: Paraquat-inducible protein B |
Gene: VF_1275: Paraquat-inducible protein B |
Gene: VSAL_I1539: Paraquat-inducible protein B |
Gene: VAS14_02963: Paraquat-inducible protein B |
Gene: PBPRA1926: Paraquat-inducible protein B |
Paraquat-inducible protein B |
| CRON 48. | |||||||||||
| frdA |
Gene: VC2656: fumarate reductase, flavoprotein subunit |
Gene: VV1_1269: fumarate reductase, flavoprotein subunit |
Gene: VIBHAR_00131: fumarate reductase, flavoprotein subunit |
Gene: VP2840: fumarate reductase, flavoprotein subunit |
*
Vibrio shilonii AK1 Site: position = -256 score = 4.85498 sequence = AAATCATAATTAAACTCATTA Gene: VSAK1_11298: fumarate reductase, flavoprotein subunit |
Gene: VS_0248: fumarate reductase, flavoprotein subunit |
*
Vibrio fischeri ES114 Site: position = -298 score = 5.25694 sequence = CAATAAGAATCATTATCACTT Gene: VF_2334: fumarate reductase, flavoprotein subunit |
*
Vibrio salmonicida LFI1238 Site: position = -256 score = 4.86504 sequence = CGATAAGAATCATTATCACTT Gene: VSAL_I2788: fumarate reductase, flavoprotein subunit |
Gene: VAS14_18896: fumarate reductase, flavoprotein subunit |
Gene: PBPRA3378: fumarate reductase, flavoprotein subunit |
fumarate reductase, flavoprotein subunit |
| frdB |
Gene: VC2657: fumarate reductase, iron-sulfur protein |
Gene: VV1_1268: fumarate reductase, iron-sulfur protein |
Gene: VIBHAR_00132: fumarate reductase, iron-sulfur protein |
Gene: VP2841: fumarate reductase, iron-sulfur protein |
Gene: VSAK1_11293: fumarate reductase, iron-sulfur protein |
Gene: VS_0247: fumarate reductase, iron-sulfur protein |
Gene: VF_2335: fumarate reductase, iron-sulfur protein |
Gene: VSAL_I2789: fumarate reductase, iron-sulfur protein |
Gene: VAS14_18901: fumarate reductase, iron-sulfur protein |
Gene: PBPRA3379: fumarate reductase, iron-sulfur protein |
fumarate reductase, iron-sulfur protein |
| frdC |
Gene: VC2658: fumarate reductase, 15 kDa hydrophobic protein |
Gene: VV1_1267: fumarate reductase, 15 kDa hydrophobic protein |
Gene: VIBHAR_00133: fumarate reductase, 15 kDa hydrophobic protein |
Gene: VP2842: fumarate reductase, 15 kDa hydrophobic protein |
Gene: VSAK1_11288: fumarate reductase, 15 kDa hydrophobic protein |
Gene: VS_0246: fumarate reductase, 15 kDa hydrophobic protein |
Gene: VF_2336: fumarate reductase, 15 kDa hydrophobic protein |
Gene: VSAL_I2790: fumarate reductase, 15 kDa hydrophobic protein |
Gene: VAS14_18906: fumarate reductase, 15 kDa hydrophobic protein |
Gene: PBPRA3380: fumarate reductase, 15 kDa hydrophobic protein |
fumarate reductase, 15 kDa hydrophobic protein |
| frdD |
Gene: VC2659: fumarate reductase, 13 kDa hydrophobic protein |
Gene: VV1_1266: fumarate reductase, 13 kDa hydrophobic protein |
Gene: VIBHAR_00134: fumarate reductase, 13 kDa hydrophobic protein |
Gene: VP2843: fumarate reductase, 13 kDa hydrophobic protein |
Gene: VSAK1_11283: fumarate reductase, 13 kDa hydrophobic protein |
Gene: VS_0245: fumarate reductase, 13 kDa hydrophobic protein |
Gene: VF_2337: fumarate reductase, 13 kDa hydrophobic protein |
Gene: VSAL_I2791: fumarate reductase, 13 kDa hydrophobic protein |
Gene: VAS14_18911: fumarate reductase, 13 kDa hydrophobic protein |
Gene: PBPRA3381: fumarate reductase, 13 kDa hydrophobic protein |
fumarate reductase, 13 kDa hydrophobic protein |
| CRON 49. | |||||||||||
| azu1 |
|
|
|
|
|
*
Vibrio splendidus LGP32 Site: position = -27 score = 5.30742 sequence = TGTTGAAAATAATTCTTATTT Gene: VS_II0661: Pseudoazurin (blue copper protein) |
|
|
|
|
Pseudoazurin (blue copper protein) |
| CRON 50. | |||||||||||
| VPA1658 |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -208 score = 5.54018 sequence = AAATAAGAACAAATATTATTT Gene: VPA1658: Vibrioferrin ligase/carboxylase protein PvsA |
|
*
Vibrio splendidus LGP32 Site: position = -211 score = 5.35018 sequence = GAATAAGAACAAATATCATTT Gene: VS_II1129: Vibrioferrin ligase/carboxylase protein PvsA |
|
|
|
|
Vibrioferrin ligase/carboxylase protein PvsA |
| VPA1659 |
|
|
|
Gene: VPA1659: Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B |
|
Gene: VS_II1130: Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B |
|
|
|
|
Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B |
| VPA1660 |
|
|
|
Gene: VPA1660: Vibrioferrin membrane-spanning transport protein PvsC |
|
Gene: VS_II1131: Vibrioferrin membrane-spanning transport protein PvsC |
|
|
|
|
Vibrioferrin membrane-spanning transport protein PvsC |
| VPA1661 |
|
|
|
Gene: VPA1661: Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A |
|
Gene: VS_II1132: Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A |
|
|
|
|
Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A |
| VPA1662 |
|
|
|
Gene: VPA1662: Vibrioferrin decarboxylase protein PvsE |
|
Gene: VS_II1133: Vibrioferrin decarboxylase protein PvsE |
|
|
|
|
Vibrioferrin decarboxylase protein PvsE |
| CRON 51. | |||||||||||
| VC0074 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -29 score = 4.46852 sequence = GTCTGAGAATAATTCGTATTT Gene: VC0074: conserved hypothetical protein |
*
Vibrio vulnificus CMCP6 Site: position = -66 score = 5.18933 sequence = AACTAAGAATTATTATTATTC Gene: VV1_1113: conserved hypothetical protein |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -78 score = 5.47783 sequence = AACTAAGAATTATTATTATTA Gene: VIBHAR_00530: conserved hypothetical protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -66 score = 5.57197 sequence = AACTAAGAATTATTATTATTT Gene: VP0074: conserved hypothetical protein |
*
Vibrio shilonii AK1 Site: position = -47 score = 4.52152 sequence = AACTAAGAATCATTCCTGTTT Gene: VSAK1_12905: conserved hypothetical protein |
*
Vibrio splendidus LGP32 Site: position = -38 score = 5.09213 sequence = AACTAAGAATCATTATTATTC Gene: VS_0088: conserved hypothetical protein |
|
|
*
Vibrio angustum S14 Site: position = -62 score = 5.17428 sequence = AATTACGAATCATTATCGTTT Gene: VAS14_22809: conserved hypothetical protein |
*
Photobacterium profundum SS9 Site: position = -19 score = 5.19297 sequence = AACTGATAATGATTAGCGTTT Gene: PBPRA3532: conserved hypothetical protein |
conserved hypothetical protein |
| CRON 52. | |||||||||||
| VSAK1_26775 |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -52 score = 5.4723 sequence = AAATGAAAGTAATTATCAATA Site: position = -46 score = 4.44498 sequence = AAGTAATTATCAATAACATTT Gene: VSAK1_26775: ferrichrome-iron receptor |
|
|
|
|
|
ferrichrome-iron receptor |
| VSAK1_26770 |
|
|
|
|
Gene: VSAK1_26770: ferrichrome-iron receptor |
|
|
|
|
|
ferrichrome-iron receptor |
| VSAK1_26765 |
|
|
|
|
Gene: VSAK1_26765: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| CRON 53. | |||||||||||
| VC0774 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -97 score = 5.66493 sequence = AAATGAGAATAGTTTTTATTA Site: position = -74 score = 4.6574 sequence = AAATGCAAGCAATTTCCATTT Gene: VC0774: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA |
*
Vibrio vulnificus CMCP6 Site: position = -122 score = 5.79037 sequence = TAACGATAATAATTATCATTA Site: position = -128 score = 4.70318 sequence = AAATGCTAACGATAATAATTA Gene: VV20834: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA |
Gene: VIBHAR_01396: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA |
|
|
|
|
|
|
Gene: PBPRB1820: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA |
2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EC 1.3.1.28) # Vibriobactin-specific, VibA |
| CRON 54. | |||||||||||
| viuA |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -290 score = 4.96512 sequence = AAATGAGAATGCTTTACATTT Gene: VC2211: Ferric aerobactin receptor, TonB-dependent |
*
Vibrio vulnificus CMCP6 Site: position = -299 score = 4.96512 sequence = AAATGAGAATGCTTTACATTT Gene: VV20843: Ferric aerobactin receptor, TonB-dependent |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -134 score = 5.18994 sequence = AAATGATAATTATTGATATTT Gene: VIBHAR_01762: Ferric aerobactin receptor, TonB-dependent |
|
|
Gene: VS_1121: Ferric aerobactin receptor, TonB-dependent |
|
|
|
|
Ferric aerobactin receptor, TonB-dependent |
| CRON 55. | |||||||||||
| VSAK1_18187 |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -64 score = 5.61338 sequence = TAATGACAATAGTTATCATTA Gene: VSAK1_18187: TonB-dependent receptor |
*
Vibrio splendidus LGP32 Site: position = -46 score = 5.49178 sequence = TAATGCAAACCATTATCATTA Site: position = -17 score = 4.88516 sequence = ATATAAGAATAAATATCATGT Gene: VS_1633: TonB-dependent receptor |
|
|
|
|
TonB-dependent receptor |
| CRON 56. | |||||||||||
| fecB |
|
|
|
|
|
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -69 score = 5.31972 sequence = AAATAAAAATAGTTATCAATC Gene: PBPRB1817: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1) |
Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1) |
| CRON 57. | |||||||||||
| VIBHAR_06301 |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -2 score = 4.93973 sequence = AAATGAGAATTAGTTTCGTTA Gene: VIBHAR_06301: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| VV21338 |
|
*
Vibrio vulnificus CMCP6 Site: position = -154 score = 5.50324 sequence = AAATGATAACCATTCTCTTTT Gene: VV21338: HTH-type transcription regulator, AraC-family |
Gene: VIBHAR_06300: HTH-type transcription regulator, AraC-family |
|
Gene: VSAK1_26780: HTH-type transcription regulator, AraC-family |
*
Vibrio splendidus LGP32 Site: position = -244 score = 4.57362 sequence = AAATGAGAATCAGTTGCGTTA Gene: VS_II0500: HTH-type transcription regulator, AraC-family |
Gene: VF_A0785: HTH-type transcription regulator, AraC-family |
Gene: VSAL_II0910: HTH-type transcription regulator, AraC-family |
|
|
HTH-type transcription regulator, AraC-family |
| CRON 58. | |||||||||||
| vibH |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -214 score = 4.79459 sequence = AAATAAAAATGTTTTTCATTG Site: position = -196 score = 4.87378 sequence = TTGTAATATTGATTCTCATTT Gene: VC0775: Amide synthase component of siderophore synthetase # Vibriobactin-specific, VibH |
*
Vibrio vulnificus CMCP6 Site: position = -79 score = 5.6077 sequence = AATTGATAACTATTATCATTG Gene: VV20844: Amide synthase component of siderophore synthetase # Vibriobactin-specific, VibH |
|
|
|
|
|
|
|
|
Amide synthase component of siderophore synthetase # Vibriobactin-specific, VibH |
| CRON 59. | |||||||||||
| VCA0576 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -60 score = 5.67749 sequence = AAATGATAGCAATTATCATTA Gene: VCA0576: TonB-dependent heme and hemoglobin receptor HutA; TonB-dependent hemin , ferrichrome receptor |
|
|
|
|
|
|
|
|
|
TonB-dependent heme and hemoglobin receptor HutA; TonB-dependent hemin , ferrichrome receptor |
| CRON 60. | |||||||||||
| VPA1434 |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -109 score = 5.45153 sequence = TAATTGTAATTATTATCATTT Gene: VPA1434: putative hemolysin secretion ATP-binding protein |
|
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -160 score = 5.40397 sequence = TAATGATAATGATTGTCATCT Gene: PBPRA1567: putative hemolysin secretion ATP-binding protein |
putative hemolysin secretion ATP-binding protein |
| CRON 61. | |||||||||||
| VSAK1_16967 |
|
|
|
|
*
Vibrio shilonii AK1 Site: position = -42 score = 4.82343 sequence = TATTAATAATAAAACTTATTA Gene: VSAK1_16967: outer membrane protein OmpU |
|
|
|
*
Vibrio angustum S14 Site: position = -74 score = 5.34295 sequence = TAATGATTACCATTCTCATTA Gene: VAS14_08970: outer membrane protein OmpU |
|
outer membrane protein OmpU |
| CRON 62. | |||||||||||
| ppaC |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -143 score = 5.1337 sequence = AGTTGAGAACTATTCGCAATT Gene: VC1687: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
*
Vibrio vulnificus CMCP6 Site: position = -163 score = 5.99285 sequence = AAATAAGAATGATTATCATTA Site: position = -137 score = 5.46499 sequence = AAGTGAGAATTATTCGCAATA Gene: VV1_2888: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -191 score = 5.91653 sequence = AAATGGTAATAATTCTCATTA Site: position = -165 score = 5.46499 sequence = AAGTGAGAATTATTCGCAATA Gene: VIBHAR_01860: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
*2
Vibrio parahaemolyticus RIMD 2210633 Site: position = -185 score = 4.4636 sequence = AAATGCAAATGGTAATAATTA Site: position = -179 score = 6.01099 sequence = AAATGGTAATAATTATCATTA Site: position = -153 score = 5.50235 sequence = AAATGAGATTTATTCGCAATA Gene: VP1165: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) Gene: VP1770: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
*
Vibrio shilonii AK1 Site: position = -192 score = 6.28269 sequence = AAATGAGAATTATTATCATTA Site: position = -166 score = 5.05425 sequence = ATATGAGAATAATTCTCAATG Gene: VSAK1_04387: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
*
Vibrio splendidus LGP32 Site: position = -161 score = 5.93749 sequence = GAATGATAATAATTATCAATT Site: position = -155 score = 4.3675 sequence = TAATAATTATCAATTGCATTC Gene: VS_2001: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
Gene: VF_A0421: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
Gene: VSAL_II0738: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
Gene: VAS14_03748: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
2
Photobacterium profundum SS9 Gene: PBPRB1355: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) Gene: PBPRA1513: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1) |
| CRON 63. | |||||||||||
| VAS14_13349 |
|
|
|
|
|
|
|
|
*
Vibrio angustum S14 Site: position = -116 score = 4.56304 sequence = ATATAGTAATAAGTCTCATTA Site: position = -53 score = 5.79037 sequence = TAACGATAATTATTATCATTA Site: position = -47 score = 4.965 sequence = TAATTATTATCATTATTATTT Gene: VAS14_13349: Periplasmic binding protein |
|
Periplasmic binding protein |
| fecD |
|
|
|
|
|
|
|
|
Gene: VAS14_13354: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) |
Gene: PBPRB1385: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) |
Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) |
| fecE |
|
|
|
|
|
|
|
|
Gene: VAS14_13359: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
Gene: PBPRB1384: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) |
| CRON 64. | |||||||||||
| iscA |
|
|
|
|
|
*
Vibrio splendidus LGP32 Site: position = -102 score = 4.50736 sequence = ATATGCAAATGATAATCAATA Site: position = -96 score = 5.71637 sequence = AAATGATAATCAATATCATCT Site: position = -207 score = 5.84201 sequence = TAATGATAATCATTATTAATA Gene: VS_1901: Iron binding protein IscA for iron-sulfur cluster assembly |
|
|
|
|
Iron binding protein IscA for iron-sulfur cluster assembly |
| sufB |
|
|
|
|
|
Gene: VS_1902: Iron-sulfur cluster assembly protein SufB |
|
|
|
|
Iron-sulfur cluster assembly protein SufB |
| sufC |
|
|
|
|
|
Gene: VS_1903: Iron-sulfur cluster assembly ATPase protein SufC |
|
|
|
|
Iron-sulfur cluster assembly ATPase protein SufC |
| sufD |
|
|
|
|
|
Gene: VS_1904: Iron-sulfur cluster assembly protein SufD |
|
|
|
|
Iron-sulfur cluster assembly protein SufD |
| sufS |
|
|
|
|
|
Gene: VS_1905: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
|
|
|
|
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
| sufE |
|
|
|
|
|
Gene: VS_1906: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
|
|
|
|
Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
| CRON 65. | |||||||||||
| VV21178 |
|
*
Vibrio vulnificus CMCP6 Site: position = -41 score = 6.37715 sequence = AAATGATAATAATTATCATTA Site: position = -38 score = 4.36211 sequence = TGATAATAATTATCATTATAT Gene: VV21178: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -46 score = 5.02391 sequence = TAATGATAATGATAATGATTA Site: position = -40 score = 5.6891 sequence = TAATGATAATGATTATCTTTT Gene: VIBHAR_07043: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -2 score = 5.7863 sequence = TAATGATAATAATTATCTTTT Gene: VPA0004: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component |
|
*
Vibrio splendidus LGP32 Site: position = -31 score = 5.9463 sequence = TAATGATAATAGTTATCAATA Gene: VS_II1528: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component |
*
Vibrio fischeri ES114 Site: position = -44 score = 5.03841 sequence = TGATAATAATGATAATCATTA Site: position = -38 score = 5.30646 sequence = TAATGATAATCATTATCTTTC Gene: VF_A0200: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component |
|
*
Vibrio angustum S14 Site: position = -53 score = 5.43268 sequence = TAATGATAATAAGTTTCATTA Site: position = -47 score = 4.68106 sequence = TAATAAGTTTCATTATCATGT Gene: VAS14_10859: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component |
|
ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component |
| VV21177 |
|
Gene: VV21177: ABC-type oligopeptide transport system, ATPase component |
|
Gene: VPA0003: ABC-type oligopeptide transport system, ATPase component |
|
Gene: VS_II1529: ABC-type oligopeptide transport system, ATPase component |
Gene: VF_A0199: ABC-type oligopeptide transport system, ATPase component |
|
Gene: VAS14_10854: ABC-type oligopeptide transport system, ATPase component |
|
ABC-type oligopeptide transport system, ATPase component |
| VCA0003 |
Gene: VCA0003: Conesrved hypothetical protein |
Gene: VV21176: Conesrved hypothetical protein |
Gene: VIBHAR_07045: Conesrved hypothetical protein |
Gene: VPA0002: Conesrved hypothetical protein |
|
Gene: VS_II1530: Conesrved hypothetical protein |
Gene: VF_A0198: Conesrved hypothetical protein |
Gene: VSAL_II0169: Conesrved hypothetical protein |
Gene: VAS14_10849: Conesrved hypothetical protein |
Gene: PBPRB0792: Conesrved hypothetical protein |
Conesrved hypothetical protein |
| CRON 66. | |||||||||||
| COG3016 |
Gene: VC2004: Conserved hypothetical iron-regulated protein |
*
Vibrio vulnificus CMCP6 Site: position = -114 score = 5.50325 sequence = TAAAGAGAATTATTCTCATTA Gene: VV1_2020: Conserved hypothetical iron-regulated protein |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -80 score = 5.42701 sequence = TAACGCTAATTATTCTCATTA Gene: VIBHAR_03054: Conserved hypothetical iron-regulated protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -80 score = 5.45329 sequence = TAACGAAAATCATTCTCATTT Gene: VP2161: Conserved hypothetical iron-regulated protein |
Gene: VSAK1_10043: Conserved hypothetical iron-regulated protein |
Gene: VS_0927: Conserved hypothetical iron-regulated protein |
*
Vibrio fischeri ES114 Site: position = -82 score = 5.47882 sequence = TACTGAGAATGATTCTTATTT Site: position = -66 score = 4.74066 sequence = TATTTATATTGATAATCATTT Site: position = -60 score = 5.52305 sequence = TATTGATAATCATTTCCATTT Gene: VF_A0756: Conserved hypothetical iron-regulated protein |
*
Vibrio salmonicida LFI1238 Site: position = -82 score = 5.17808 sequence = AGTTGATAATGATTACTATTA Gene: VSAL_II0868: Conserved hypothetical iron-regulated protein |
*
Vibrio angustum S14 Site: position = -93 score = 5.15586 sequence = AATTGATAATAACTCGTATTA Gene: VAS14_06553: Conserved hypothetical iron-regulated protein |
*
Photobacterium profundum SS9 Site: position = -190 score = 5.4434 sequence = TATTGATATTGATTATCAGTT Site: position = -167 score = 4.86396 sequence = ATTTGATAATCAATATCAACT Gene: PBPRA2792: Conserved hypothetical iron-regulated protein |
Conserved hypothetical iron-regulated protein |
| CRON 67. | |||||||||||
| VC0877 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = 20 score = 4.87186 sequence = AATTAATAATTATTCTCAAGG Gene: VC0877: hypothetical protein |
|
|
|
|
|
|
|
|
|
hypothetical protein |
| yaeB |
Gene: VC0876: conserved hypothetical protein |
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -81 score = 5.14044 sequence = AATTAATAATCATTCTCAAAA Gene: VIBHAR_03251: hypothetical protein |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -81 score = 5.32437 sequence = AATTAATAATCATTCCCAATA Gene: VP2332: conserved hypothetical protein |
Gene: VSAK1_11800: hypothetical protein |
*
Vibrio splendidus LGP32 Site: position = -81 score = 5.6759 sequence = AAATGATAATTATTATCAAAA Gene: VS_2367: transcriptional regulator |
Gene: VF_0683: hypothetical protein |
*
Vibrio salmonicida LFI1238 Site: position = -89 score = 5.22112 sequence = AATTGCGAACTATTATCATAT Gene: VSAL_I0891: hypothetical protein |
Gene: VAS14_21071: hypothetical protein |
Gene: PBPRA2943: conserved hypothetical protein |
conserved hypothetical protein |
| CRON 68. | |||||||||||
| ptrB |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -76 score = 5.73282 sequence = AAATGATAATTGATCTTATTT Gene: VCA0063: Protease II (EC 3.4.21.83) |
*
Vibrio vulnificus CMCP6 Site: position = -155 score = 5.77431 sequence = AATTGATATCTATTCTCATTT Site: position = -103 score = 5.3432 sequence = AAATGATAATTGATGTTATTT Gene: VV21548: Protease II (EC 3.4.21.83) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -80 score = 5.92547 sequence = AAATGATAATTGATCTCATTT Gene: VIBHAR_05127: Protease II (EC 3.4.21.83) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -79 score = 5.92547 sequence = AAATGATAATTGATCTCATTT Gene: VPA1467: Protease II (EC 3.4.21.83) |
|
|
*
Vibrio fischeri ES114 Site: position = -85 score = 4.35258 sequence = AAATGAAAATGATAATTGATC Site: position = -79 score = 5.54283 sequence = AAATGATAATTGATCTCATTC Gene: VF_A0333: Protease II (EC 3.4.21.83) |
|
|
*
Photobacterium profundum SS9 Site: position = -73 score = 4.9661 sequence = AAATGAGAATCATTCTTGATC Gene: PBPRB0979: Protease II (EC 3.4.21.83) |
Protease II (EC 3.4.21.83) |
| hutR |
Gene: VCA0064: TonB-dependent heme receptor HutR |
Gene: VV21549: TonB-dependent heme receptor HutR |
Gene: VIBHAR_05128: TonB-dependent heme receptor HutR |
Gene: VPA1466: TonB-dependent heme receptor HutR |
|
|
Gene: VF_A0332: TonB-dependent heme receptor HutR |
|
|
Gene: PBPRB0978: TonB-dependent heme receptor HutR |
TonB-dependent heme receptor HutR |
| VIBHAR_03587 |
|
|
Gene: VIBHAR_05129: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| VIBHAR_05130 |
|
|
Gene: VIBHAR_05130: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| VCA0065 |
Gene: VCA0065: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase |
Gene: VV21550: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase |
2
Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05131: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Gene: VIBHAR_05132: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase |
Gene: VPA1465: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase |
|
|
Gene: VF_A0331: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase |
|
|
Gene: PBPRB0977: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase |
Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase |
| VCA0066 |
Gene: VCA0066: Hypothetical protein in cluster with HutR, VCA0066 homolog |
Gene: VV21551: Hypothetical protein in cluster with HutR, VCA0066 homolog |
2
Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_05133: Hypothetical protein in cluster with HutR, VCA0066 homolog Gene: VIBHAR_05134: Hypothetical protein in cluster with HutR, VCA0066 homolog |
Gene: VPA1464: Hypothetical protein in cluster with HutR, VCA0066 homolog |
|
|
Gene: VF_A0330: Hypothetical protein in cluster with HutR, VCA0066 homolog |
|
|
Gene: PBPRB0976: Hypothetical protein in cluster with HutR, VCA0066 homolog |
Hypothetical protein in cluster with HutR, VCA0066 homolog |
| VCA0067 |
Gene: VCA0067: Hypothetical protein in cluster with HutR, VCA0067 homolog |
Gene: VV21552: Hypothetical protein in cluster with HutR, VCA0067 homolog |
Gene: VIBHAR_05135: Hypothetical protein in cluster with HutR, VCA0067 homolog |
Gene: VPA1463: Hypothetical protein in cluster with HutR, VCA0067 homolog |
|
|
Gene: VF_A0329: Hypothetical protein in cluster with HutR, VCA0067 homolog |
|
|
|
Hypothetical protein in cluster with HutR, VCA0067 homolog |
| PBPRB0975 |
|
|
|
|
|
|
|
|
|
Gene: PBPRB0975: hypothetical protein |
hypothetical protein |
| CRON 69. | |||||||||||
| vctP |
|
|
|
|
|
|
*
Vibrio fischeri ES114 Site: position = -65 score = 5.56805 sequence = TAATAATAACCATTTTCATTA Site: position = -34 score = 5.42656 sequence = AAATACGAATAGTTATCACTT Gene: VF_A0827: ferric anguibactin-binding protein |
|
|
|
iron(III) ABC transporter, periplasmic iron-compound-binding protein |
| vctD |
|
|
|
|
|
|
Gene: VF_A0826: ferric anguibactin transport system permease protein FatD |
|
|
|
iron(III) ABC transporter, permease protein |
| VCA0229 |
|
|
|
|
|
|
Gene: VF_A0825: ferric anguibactin transport system permease protein FatC |
|
|
|
iron(III) ABC transporter, permease protein |
| vctC |
|
|
|
|
|
|
Gene: VF_A0824: ferric anguibactin transport ATP-binding protein |
|
|
|
iron(III) ABC transporter, ATP-binding protein |
| VIBHAR_06920 |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = 4 score = 4.42241 sequence = GAAAGAGAATTGTTATCAAAA Gene: VIBHAR_06920: Siderophore-interacting protein ViuB |
Gene: VPA0089: Siderophore-interacting protein ViuB |
*
Vibrio shilonii AK1 Site: position = -31 score = 5.38917 sequence = AAATGAAAACAATAATCATTA Gene: VSAK1_05955: Siderophore-interacting protein ViuB |
*
Vibrio splendidus LGP32 Site: position = -76 score = 5.2973 sequence = AAATGATAACTATTAGTATTG Gene: VS_II0412: Siderophore-interacting protein ViuB |
Gene: VF_A0823: Siderophore-interacting protein ViuB |
|
*
Vibrio angustum S14 Site: position = -29 score = 5.51071 sequence = AAATAAAAACCATTCTCAATT Gene: VAS14_04423: Siderophore-interacting protein ViuB |
|
Siderophore-interacting protein ViuB |
| CRON 70. | |||||||||||
| nrfB |
|
*
Vibrio vulnificus CMCP6 Site: position = -144 score = 5.24875 sequence = AAATAAGAATTGATGTCATTT Site: position = -76 score = 5.5451 sequence = AATTGAAAATGATTCTTAATT Gene: VV1_3034: Cytochrome c-type protein NrfB precursor |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -118 score = 5.24875 sequence = AAATAAGAATTGATGTCATTT Site: position = -46 score = 5.88896 sequence = AATTGAGAATAGTTATCAATT Gene: VIBHAR_02726: Cytochrome c-type protein NrfB precursor |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -140 score = 5.24875 sequence = AAATAAGAATTGATGTCATTT Site: position = -70 score = 5.31152 sequence = AGTTGAGAACAGTTATCAATT Gene: VP1928: Cytochrome c-type protein NrfB precursor |
*
Vibrio shilonii AK1 Site: position = -274 score = 5.71943 sequence = TGATGATATTAATTATCATTT Site: position = -125 score = 4.88862 sequence = AAATAAGAATTGATTACATTT Gene: VSAK1_05595: Cytochrome c-type protein NrfB precursor |
*
Vibrio splendidus LGP32 Site: position = -263 score = 5.40717 sequence = AACTGAGAATTATTATCATAT Site: position = -113 score = 5.73282 sequence = AAATAAGAATTGATATCATTT Gene: VS_1932: Cytochrome c-type protein NrfB precursor |
*
Vibrio fischeri ES114 Site: position = -264 score = 5.5546 sequence = TATTAAGAATGATTCTTATTT Gene: VF_1553: Cytochrome c-type protein NrfB precursor |
*
Vibrio salmonicida LFI1238 Site: position = -286 score = 5.4635 sequence = TATTAATAATGGTTCTTATTT Site: position = -127 score = 4.48097 sequence = CAATGAGAATTGATTTCAATG Gene: VSAL_I1998: Cytochrome c-type protein NrfB precursor |
|
*
Photobacterium profundum SS9 Site: position = -208 score = 4.75395 sequence = TAATGAGAATGGGTGTCAATT Site: position = -191 score = 5.09667 sequence = AATTGCAAATGGTTTTTATTT Gene: PBPRA1259: Cytochrome c-type protein NrfB precursor |
Cytochrome c-type protein NrfB precursor |
| nfrC |
|
Gene: VV1_3033: Putative nitrite reductase, Fe-S protein (NrfC) |
2
Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_02725: Putative nitrite reductase, Fe-S protein (NrfC) Gene: VIBHAR_02724: Putative nitrite reductase, Fe-S protein (NrfC) |
Gene: VP1927: Putative nitrite reductase, Fe-S protein (NrfC) |
Gene: VSAK1_05590: Putative nitrite reductase, Fe-S protein (NrfC) |
Gene: VS_1931: Putative nitrite reductase, Fe-S protein (NrfC) |
Gene: VF_1552: Putative nitrite reductase, Fe-S protein (NrfC) |
Gene: VSAL_I1999: Putative nitrite reductase, Fe-S protein (NrfC) |
|
Gene: PBPRA1260: Putative nitrite reductase, Fe-S protein (NrfC) |
Putative nitrite reductase, Fe-S protein (NrfC) |
| nrfD |
|
Gene: VV1_3032: Putative nitrate reductase, formate dependent (NrfD) |
Gene: VIBHAR_02723: Putative nitrate reductase, formate dependent (NrfD) |
Gene: VP1926: Putative nitrate reductase, formate dependent (NrfD) |
Gene: VSAK1_05585: Putative nitrate reductase, formate dependent (NrfD) |
Gene: VS_1930: Putative nitrate reductase, formate dependent (NrfD) |
Gene: VF_1551: Putative nitrate reductase, formate dependent (NrfD) |
Gene: VSAL_I2000: Putative nitrate reductase, formate dependent (NrfD) |
|
Gene: PBPRA1261: Putative nitrate reductase, formate dependent (NrfD) |
Putative nitrate reductase, formate dependent (NrfD) |
| CRON 71. | |||||||||||
| tonB-hmu |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -170 score = 5.33368 sequence = AATTGATAATTGCTATTATTA Gene: VCA0910: Periplasmic protein TonB involved in hemin uptake |
*
Vibrio vulnificus CMCP6 Site: position = -115 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Gene: VV21614: Periplasmic protein TonB involved in hemin uptake |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -79 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Site: position = -34 score = 5.31682 sequence = AGTTGATAATGATTAGCAATA Gene: VIBHAR_05244: Periplasmic protein TonB involved in hemin uptake |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -74 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Gene: VPA0426: Periplasmic protein TonB involved in hemin uptake |
*2
Vibrio shilonii AK1 Site: position = -78 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Gene: VSAK1_22229: Periplasmic protein TonB involved in hemin uptake Gene: VSAK1_22224: Periplasmic protein TonB involved in hemin uptake |
*
Vibrio splendidus LGP32 Site: position = -67 score = 5.58166 sequence = AATTGATAATTGATCTTATTT Gene: VS_II0289: Periplasmic protein TonB involved in hemin uptake |
*
Vibrio fischeri ES114 Site: position = -65 score = 5.68017 sequence = AATTGATAATTGATCTCATTA Gene: VF_1225: Periplasmic protein TonB involved in hemin uptake |
|
*
Vibrio angustum S14 Site: position = -190 score = 5.44464 sequence = AAATGATAATTGATATTATTC Gene: VAS14_03958: Periplasmic protein TonB involved in hemin uptake |
*
Photobacterium profundum SS9 Site: position = -196 score = 5.82117 sequence = AAATGATAATCAATCTTATTT Site: position = -141 score = 5.44464 sequence = AAATGATAATTGATATTATTC Gene: PBPRA2103: Periplasmic protein TonB involved in hemin uptake |
Periplasmic protein TonB involved in hemin uptake |
| exbB-hmu |
Gene: VCA0911: TonB system transport protein ExbB involved in hemin uptake |
Gene: VV21613: TonB system transport protein ExbB involved in hemin uptake |
Gene: VIBHAR_05243: TonB system transport protein ExbB involved in hemin uptake |
Gene: VPA0425: TonB system transport protein ExbB involved in hemin uptake |
Gene: VSAK1_22219: TonB system transport protein ExbB involved in hemin uptake |
Gene: VS_II0288: TonB system transport protein ExbB involved in hemin uptake |
Gene: VF_1224: TonB system transport protein ExbB involved in hemin uptake |
Gene: VSAL_I1752: TonB system transport protein ExbB involved in hemin uptake |
Gene: VAS14_03963: TonB system transport protein ExbB involved in hemin uptake |
Gene: PBPRA2104: TonB system transport protein ExbB involved in hemin uptake |
TonB system transport protein ExbB involved in hemin uptake |
| exbD-hmu |
Gene: VCA0912: TonB system transport protein ExbD involved in hemin uptake |
Gene: VV21612: TonB system transport protein ExbD involved in hemin uptake |
Gene: VIBHAR_05242: TonB system transport protein ExbD involved in hemin uptake |
Gene: VPA0424: TonB system transport protein ExbD involved in hemin uptake |
Gene: VSAK1_22214: TonB system transport protein ExbD involved in hemin uptake |
Gene: VS_II0287: TonB system transport protein ExbD involved in hemin uptake |
Gene: VF_1223: TonB system transport protein ExbD involved in hemin uptake |
Gene: VSAL_I1753: TonB system transport protein ExbD involved in hemin uptake |
Gene: VAS14_03968: TonB system transport protein ExbD involved in hemin uptake |
Gene: PBPRA2105: TonB system transport protein ExbD involved in hemin uptake |
TonB system transport protein ExbD involved in hemin uptake |
| hmuT |
Gene: VCA0913: Hemin ABC transporter, periplasmic hemin-binding protein |
Gene: VV21611: Hemin ABC transporter, periplasmic hemin-binding protein |
Gene: VIBHAR_05241: Hemin ABC transporter, periplasmic hemin-binding protein |
Gene: VPA0423: Hemin ABC transporter, periplasmic hemin-binding protein |
Gene: VSAK1_22209: Hemin ABC transporter, periplasmic hemin-binding protein |
Gene: VS_II0286: Hemin ABC transporter, periplasmic hemin-binding protein |
Gene: VF_1222: Hemin ABC transporter, periplasmic hemin-binding protein |
Gene: VSAL_I1754: Hemin ABC transporter, periplasmic hemin-binding protein |
Gene: VAS14_03973: Hemin ABC transporter, periplasmic hemin-binding protein |
Gene: PBPRA2106: Hemin ABC transporter, periplasmic hemin-binding protein |
Hemin ABC transporter, periplasmic hemin-binding protein |
| hmuU |
Gene: VCA0914: Hemin ABC transporter, permease component |
Gene: VV21610: Hemin ABC transporter, permease component |
Gene: VIBHAR_05240: Hemin ABC transporter, permease component |
Gene: VPA0422: Hemin ABC transporter, permease component |
Gene: VSAK1_22204: Hemin ABC transporter, permease component |
Gene: VS_II0285: Hemin ABC transporter, permease component |
Gene: VF_1221: Hemin ABC transporter, permease component |
Gene: VSAL_I1755: Hemin ABC transporter, permease component |
Gene: VAS14_03978: Hemin ABC transporter, permease component |
Gene: PBPRA2107: Hemin ABC transporter, permease component |
Hemin ABC transporter, permease component |
| hmuV |
Gene: VCA0915: Hemin ABC transporter, ATP-binding subunit |
Gene: VV21609: Hemin ABC transporter, ATP-binding subunit |
Gene: VIBHAR_05239: Hemin ABC transporter, ATP-binding subunit |
Gene: VPA0421: Hemin ABC transporter, ATP-binding subunit |
Gene: VSAK1_22199: Hemin ABC transporter, ATP-binding subunit |
Gene: VS_II0284: Hemin ABC transporter, ATP-binding subunit |
Gene: VF_1220: Hemin ABC transporter, ATP-binding subunit |
Gene: VSAL_I1756: Hemin ABC transporter, ATP-binding subunit |
Gene: VAS14_03983: Hemin ABC transporter, ATP-binding subunit |
Gene: PBPRA2108: Hemin ABC transporter, ATP-binding subunit |
Hemin ABC transporter, ATP-binding subunit |
| CRON 72. | |||||||||||
| fhuE |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -97 score = 5.4355 sequence = AAATGGTAATAGTTGTCATTT Gene: VIBHAR_06761: Putative ferrichrome-iron receptor |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -98 score = 5.33163 sequence = AAATGGTAATACTTATCACTT Gene: VPA0150: Putative ferrichrome-iron receptor |
|
*
Vibrio splendidus LGP32 Site: position = -124 score = 5.42376 sequence = AAATAGTAATAGTTATCACTT Gene: VS_II0677: Putative ferrichrome-iron receptor |
*
Vibrio fischeri ES114 Site: position = -83 score = 5.91957 sequence = AAATGGTAACAATTATCATTT Gene: VF_A0191: Putative ferrichrome-iron receptor |
*
Vibrio salmonicida LFI1238 Site: position = -82 score = 5.75632 sequence = AAATAAAAACGATTATCATTT Gene: VSAL_II0110: Putative ferrichrome-iron receptor |
*
Vibrio angustum S14 Site: position = -189 score = 5.51921 sequence = AAATGGTAATGGTTATCACTT Gene: VAS14_12509: Putative ferrichrome-iron receptor |
*
Photobacterium profundum SS9 Site: position = -160 score = 5.71365 sequence = AAATGCTAACAATTATCACTT Gene: PBPRB1222: Putative ferrichrome-iron receptor |
Putative ferrichrome-iron receptor |
| PF11932 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -58 score = 4.76526 sequence = TAATGAGAGCGTTTCTCAATA Gene: VC1548: hypothetical protein |
*
Vibrio vulnificus CMCP6 Site: position = -58 score = 5.74796 sequence = TAATGCGAATAAATATCATTT Gene: VV20364: hypothetical protein |
Gene: VIBHAR_06760: hypothetical protein |
Gene: VPA0151: hypothetical protein |
*
Vibrio shilonii AK1 Site: position = -225 score = 5.3043 sequence = AAATGATAACTCATATCAATA Gene: VSAK1_26760: hypothetical protein |
*
Vibrio splendidus LGP32 Site: position = -61 score = 4.85912 sequence = TAATGAGACTGCTTATCAATA Gene: VS_II0678: hypothetical protein |
Gene: VF_A0192: hypothetical protein |
Gene: VSAL_II0111: hypothetical protein |
Gene: VAS14_12504: hypothetical protein |
*
Photobacterium profundum SS9 Site: position = -98 score = 5.62308 sequence = AAATGAGATTCATTTTCAATT Site: position = -20 score = 4.44474 sequence = AAATACTATTGATGAGCAATA Gene: PBPRB0694: hypothetical protein |
hypothetical protein |
| exbB1 |
Gene: VC1547: Biopolymer transport protein ExbB-related protein |
Gene: VV20363: Biopolymer transport protein ExbB-related protein |
Gene: VIBHAR_06759: Biopolymer transport protein ExbB-related protein |
Gene: VPA0152: Biopolymer transport protein ExbB-related protein |
Gene: VSAK1_26755: Biopolymer transport protein ExbB-related protein |
Gene: VS_II0679: Biopolymer transport protein ExbB-related protein |
Gene: VF_A0193: Biopolymer transport protein ExbB-related protein |
Gene: VSAL_II0112: Biopolymer transport protein ExbB-related protein |
Gene: VAS14_12499: Biopolymer transport protein ExbB-related protein |
Gene: PBPRB0695: Biopolymer transport protein ExbB-related protein |
Biopolymer transport protein ExbB-related protein |
| exbB2 |
Gene: VC1546: TonB system transport protein ExbB2 |
Gene: VV20362: TonB system transport protein ExbB2 |
Gene: VIBHAR_06758: TonB system transport protein ExbB2 |
Gene: VPA0153: TonB system transport protein ExbB2 |
Gene: VSAK1_26750: TonB system transport protein ExbB2 |
Gene: VS_II0680: TonB system transport protein ExbB2 |
Gene: VF_A0194: TonB system transport protein ExbB2 |
Gene: VSAL_II0113: TonB system transport protein ExbB2 |
Gene: VAS14_12494: TonB system transport protein ExbB2 |
Gene: PBPRB0696: TonB system transport protein ExbB2 |
TonB system transport protein ExbB2 |
| exbD2 |
|
Gene: VV20361: TonB system transport protein ExbD2 |
Gene: VIBHAR_06757: TonB system transport protein ExbD2 |
Gene: VPA0154: TonB system transport protein ExbD2 |
Gene: VSAK1_26745: TonB system transport protein ExbD2 |
Gene: VS_II0681: TonB system transport protein ExbD2 |
Gene: VF_A0195: TonB system transport protein ExbD2 |
Gene: VSAL_II0114: TonB system transport protein ExbD2 |
Gene: VAS14_12489: TonB system transport protein ExbD2 |
Gene: PBPRB0697: TonB system transport protein ExbD2 |
TonB system transport protein ExbD2 |
| tonB |
Gene: VC1544: Periplasmic protein TonB |
Gene: VV20360: Periplasmic protein TonB |
Gene: VIBHAR_06756: Periplasmic protein TonB |
Gene: VPA0155: Periplasmic protein TonB |
Gene: VSAK1_26740: Periplasmic protein TonB |
Gene: VS_II0682: Periplasmic protein TonB |
Gene: VF_A0196: Periplasmic protein TonB |
Gene: VSAL_II0115: Periplasmic protein TonB |
Gene: VAS14_12484: Periplasmic protein TonB |
Gene: PBPRB0698: Periplasmic protein TonB |
Periplasmic protein TonB |
| VC1543 |
Gene: VC1543: TPR domain protein, putative component of TonB system |
Gene: VV20359: TPR domain protein, putative component of TonB system |
Gene: VIBHAR_06755: TPR domain protein, putative component of TonB system |
Gene: VPA0156: TPR domain protein, putative component of TonB system |
Gene: VSAK1_26735: TPR domain protein, putative component of TonB system |
Gene: VS_II0683: TPR domain protein, putative component of TonB system |
Gene: VF_A0197: TPR domain protein, putative component of TonB system |
Gene: VSAL_II0116: TPR domain protein, putative component of TonB system |
Gene: VAS14_12479: TPR domain protein, putative component of TonB system |
Gene: PBPRB0699: TPR domain protein, putative component of TonB system |
TPR domain protein, putative component of TonB system |
| CRON 73. | |||||||||||
| feoA |
|
|
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -242 score = 4.83329 sequence = AGATAATATTTATTCTGATTA Site: position = -42 score = 5.80368 sequence = AAATAATAATATTTATCATTA Gene: VP0857: Ferrous iron transport protein A |
|
|
|
|
|
|
Ferrous iron transport protein A |
| CRON 74. | |||||||||||
| sitA |
|
|
|
|
|
|
|
|
*
Vibrio angustum S14 Site: position = -83 score = 4.75015 sequence = TAATAATTATCAATTGCATTT Site: position = -89 score = 6.07483 sequence = TATTGATAATAATTATCAATT Gene: VAS14_10539: Manganese ABC transporter, periplasmic-binding protein SitA |
|
Manganese ABC transporter, periplasmic-binding protein SitA |
| sitB |
|
|
|
|
|
|
|
|
Gene: VAS14_10534: Manganese ABC transporter, ATP-binding protein SitB |
|
Manganese ABC transporter, ATP-binding protein SitB |
| sitC |
|
|
|
|
|
|
|
|
Gene: VAS14_10529: Manganese ABC transporter, inner membrane permease protein SitC |
|
Manganese ABC transporter, inner membrane permease protein SitC |
| sitD |
|
|
|
|
|
|
|
|
Gene: VAS14_10524: Manganese ABC transporter, inner membrane permease protein SitD |
|
Manganese ABC transporter, inner membrane permease protein SitD |
| CRON 75. | |||||||||||
| VV20568 |
|
*
Vibrio vulnificus CMCP6 Site: position = -317 score = 6.20547 sequence = AAATGATAATAAATATCATTT Gene: VV20568: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -197 score = 4.57184 sequence = CAATGTAAATGGTTCTCAATT Gene: VIBHAR_06272: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -252 score = 5.00459 sequence = TAATGTAAATGGTTCTCAATT Gene: VPA0536: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Gene: VSAK1_17012: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Gene: VS_II0365: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
|
|
Gene: VAS14_21827: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Gene: PBPRA0167: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
Cytochrome c oxidase polypeptide II (EC 1.9.3.1) |
| VV20567 |
|
Gene: VV20567: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: VIBHAR_06271: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: VPA0537: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: VSAK1_17007: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: VS_II0366: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
|
|
Gene: VAS14_21822: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Gene: PBPRA0168: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
Cytochrome c oxidase polypeptide I (EC 1.9.3.1) |
| VV20566 |
|
Gene: VV20566: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: VIBHAR_06270: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: VPA0538: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: VSAK1_17002: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: VS_II0367: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
|
|
Gene: VAS14_21817: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Gene: PBPRA0169: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 |
| VV20565 |
|
Gene: VV20565: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: VIBHAR_06269: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: VPA0539: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: VSAK1_16997: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: VS_II0368: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
|
|
Gene: VAS14_21812: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Gene: PBPRA0170: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
| CRON 76. | |||||||||||
| feoA |
|
|
|
|
|
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -97 score = 5.23365 sequence = AAACTATAATAGTTATCATTT Gene: PBPRB1905: Ferrous iron transport protein A |
Ferrous iron transport protein A |
| feoB |
|
|
|
|
|
|
|
|
|
Gene: PBPRB1904: Ferrous iron transport protein B |
Ferrous iron transport protein B |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |