Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing VIBHAR_03587 gene

Properties
Regulog: Fur - Vibrionales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 447 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio harveyi ATCC BAA-1116
Position: -80
Score: 5.92547
Sequence: AAATGATAATTGATCTCATTT
Locus tag: VIBHAR_05127
Name: ptrB
Funciton: Protease II (EC 3.4.21.83)
Locus tag: VIBHAR_05128
Name: hutR
Funciton: TonB-dependent heme receptor HutR
Locus tag: VIBHAR_05129
Name: null
Funciton: hypothetical protein
Locus tag: VIBHAR_05130
Name: null
Funciton: hypothetical protein
Locus tag: VIBHAR_05131
Name: VCA0065
Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
Locus tag: VIBHAR_05132
Name: VCA0065
Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
Locus tag: VIBHAR_05133
Name: VCA0066
Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog
Locus tag: VIBHAR_05134
Name: VCA0066
Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog
Locus tag: VIBHAR_05135
Name: VCA0067
Funciton: Hypothetical protein in cluster with HutR, VCA0067 homolog
ptrB-hutR-VIBHAR_05129-VIBHAR_05130-VCA0065-VCA0065-VCA0066-VCA0066-VCA0067 -80 5.9 AAATGATAATTGATCTCATTT VIBHAR_05127