Regulon of Fur in Vibrio salmonicida LFI1238

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAL_I0833
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Vibrionales
Statistics of regulated genes:
- Genes	54
- Operons	21
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 447 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -147 Score: 5.8 Sequence: AAATGAGATCAATTATCAATT Locus tag: VSAL_I1750 Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake Locus tag: VSAL_I1749 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: VSAL_I1748 Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
	VSAL_I1750	hutW	Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
	VSAL_I1749	huvX	Putative heme iron utilization protein
	VSAL_I1748	hutZ	Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
Position: -40 Score: 4.7 Sequence: AATTGGTAATGATAGTCATTA Position: -34 Score: 5.4 Sequence: TAATGATAGTCATTATCATCT Locus tag: VSAL_I2892 Name: COG3315 Funciton: O-Methyltransferase involved in polyketide biosynthesis
	VSAL_I2892	COG3315	O-Methyltransferase involved in polyketide biosynthesis
Position: -61 Score: 4.7 Sequence: CAACGCAAATCATTATCAATT Locus tag: VSAL_II0118 Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake Locus tag: VSAL_II0119 Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271) Locus tag: VSAL_II0120 Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component Locus tag: VSAL_II0121 Name: VIBHAR_06747 Funciton: conserved hypothetical protein Locus tag: VSAL_II0122 Name: VIBHAR_06746 Funciton: conserved hypothetical protein Locus tag: VSAL_II0123 Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein Locus tag: VSAL_II0124 Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: VSAL_II0125 Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components Locus tag: VSAL_II0126 Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
	VSAL_II0118	PF03929	Uncharacterized protein involved in iron uptake
	VSAL_II0119	PF10029	Predicted periplasmic protein (DUF2271)
	VSAL_II0120	cbiM	ABC-type Co2+ transport system, periplasmic component
	VSAL_II0121	VIBHAR_06747	conserved hypothetical protein
	VSAL_II0122	VIBHAR_06746	conserved hypothetical protein
	VSAL_II0123	PF01297	ABC transporter, metal-binding lipoprotein
	VSAL_II0124	COG1121	ABC-type Mn/Zn transport systems, ATPase component
	VSAL_II0125	COG1108	ABC-type Mn2+/Zn2+ transport systems, permease components
	VSAL_II0126	COG0803	ABC-type metal ion transport system, periplasmic component/surface adhesin
Position: -227 Score: 5.5 Sequence: AAATAAGAACCATTATTAATA Locus tag: VSAL_I1997 Name: nrfA Funciton: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
	VSAL_I1997	nrfA	Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
Position: -61 Score: 6.1 Sequence: TAATGATAATAATTCTCAATT Locus tag: VSAL_I1864 Name: PF10952 Funciton: Protein of unknown function (DUF2753)
	VSAL_I1864	PF10952	Protein of unknown function (DUF2753)
Position: -81 Score: 5.4 Sequence: GAATAAAAACAATTATCATTA Position: -75 Score: 4.6 Sequence: AAACAATTATCATTACTATTT Locus tag: VSAL_II0150 Name: fhuC Funciton: ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component Locus tag: VSAL_II0151 Name: fhuD Funciton: ABC-type Fe3+-hydroxamate transport system, periplasmic component Locus tag: VSAL_II0152 Name: fhuB Funciton: ABC-type Fe3+-siderophore transport system, permease component
	VSAL_II0150	fhuC	ABC-type cobalamin/Fe3+-siderophores transport system, ATPase component
	VSAL_II0151	fhuD	ABC-type Fe3+-hydroxamate transport system, periplasmic component
	VSAL_II0152	fhuB	ABC-type Fe3+-siderophore transport system, permease component
Position: -82 Score: 5.8 Sequence: AAATAAAAACGATTATCATTT Locus tag: VSAL_II0110 Name: fhuE Funciton: Putative ferrichrome-iron receptor Locus tag: VSAL_II0111 Name: PF11932 Funciton: hypothetical protein Locus tag: VSAL_II0112 Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein Locus tag: VSAL_II0113 Name: exbB2 Funciton: TonB system transport protein ExbB2 Locus tag: VSAL_II0114 Name: exbD2 Funciton: TonB system transport protein ExbD2 Locus tag: VSAL_II0115 Name: tonB Funciton: Periplasmic protein TonB Locus tag: VSAL_II0116 Name: VC1543 Funciton: TPR domain protein, putative component of TonB system
	VSAL_II0110	fhuE	Putative ferrichrome-iron receptor
	VSAL_II0111	PF11932	hypothetical protein
	VSAL_II0112	exbB1	Biopolymer transport protein ExbB-related protein
	VSAL_II0113	exbB2	TonB system transport protein ExbB2
	VSAL_II0114	exbD2	TonB system transport protein ExbD2
	VSAL_II0115	tonB	Periplasmic protein TonB
	VSAL_II0116	VC1543	TPR domain protein, putative component of TonB system
Position: -150 Score: 4.6 Sequence: AAATAGTAATGATAATTGTTT Position: -144 Score: 5.4 Sequence: TAATGATAATTGTTTTTATTC Locus tag: VSAL_II0149 Name: PF07690 Funciton: MFS transporter
	VSAL_II0149	PF07690	MFS transporter
Position: -128 Score: 5.5 Sequence: TAATGATAAATATTTGCATTT Position: -83 Score: 5.7 Sequence: AAATAACAATAATTATCATTA Locus tag: VSAL_I1786 Name: irpA Funciton: Iron-regulated protein A precursor
	VSAL_I1786	irpA	Iron-regulated protein A precursor
Position: -56 Score: 4.7 Sequence: GCAAGAGAATCATTCTCATTT Locus tag: VSAL_II0909 Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores Locus tag: VSAL_II0908 Name: fhuC Funciton: Ferrichrome transport ATP-binding protein FhuC
	VSAL_II0909	fhuA	TonB-dependent outer membrane receptor for iron siderophores
	VSAL_II0908	fhuC	Ferrichrome transport ATP-binding protein FhuC
Position: -20 Score: 5 Sequence: TAATAGGAATCATTCTCATTG Locus tag: VSAL_I1541 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VSAL_I1540 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VSAL_I1539 Name: pqiB Funciton: Paraquat-inducible protein B
	VSAL_I1541	VV1_2646	ABC-type multidrug transport system, ATPase and permease component
	VSAL_I1540	pqiA	Paraquat-inducible protein A
	VSAL_I1539	pqiB	Paraquat-inducible protein B
Position: -82 Score: 5.2 Sequence: AGTTGATAATGATTACTATTA Locus tag: VSAL_II0868 Name: COG3016 Funciton: Conserved hypothetical iron-regulated protein
	VSAL_II0868	COG3016	Conserved hypothetical iron-regulated protein
Position: -89 Score: 5.2 Sequence: AATTGCGAACTATTATCATAT Locus tag: VSAL_I0891 Name: null Funciton: hypothetical protein
	VSAL_I0891		hypothetical protein
Position: -286 Score: 5.5 Sequence: TATTAATAATGGTTCTTATTT Position: -127 Score: 4.5 Sequence: CAATGAGAATTGATTTCAATG Locus tag: VSAL_I1998 Name: nrfB Funciton: Cytochrome c-type protein NrfB precursor Locus tag: VSAL_I1999 Name: nfrC Funciton: Putative nitrite reductase, Fe-S protein (NrfC) Locus tag: VSAL_I2000 Name: nrfD Funciton: Putative nitrate reductase, formate dependent (NrfD)
	VSAL_I1998	nrfB	Cytochrome c-type protein NrfB precursor
	VSAL_I1999	nfrC	Putative nitrite reductase, Fe-S protein (NrfC)
	VSAL_I2000	nrfD	Putative nitrate reductase, formate dependent (NrfD)
Position: -66 Score: 5.7 Sequence: AAATGAGATTCATTATTATTA Locus tag: pVSAL320_27 Name: null Funciton: putative periplasmic iron siderophore binding protein of ABC transporter Locus tag: pVSAL320_28 Name: null Funciton: transport system permease protein Locus tag: pVSAL320_29 Name: null Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1) Locus tag: pVSAL320_30 Name: null Funciton: hypothetical protein
	pVSAL320_27		putative periplasmic iron siderophore binding protein of ABC transporter
	pVSAL320_28		transport system permease protein
	pVSAL320_29		Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
	pVSAL320_30		hypothetical protein
Position: -53 Score: 5.4 Sequence: TATTGATAAGTATTCTTATTA Locus tag: VSAL_I2588 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VSAL_I2587 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VSAL_I2586 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	VSAL_I2588	fbpA	Ferric iron ABC transporter, iron-binding protein
	VSAL_I2587	fbpB	Ferric iron ABC transporter, permease protein
	VSAL_I2586	fbpC	Ferric iron ABC transporter, ATP-binding protein
Position: -30 Score: 5 Sequence: AAATAAGAATAATTACTAAGT Locus tag: VSAL_II0573 Name: VIBHAR_01767 Funciton: hypothetical protein
	VSAL_II0573	VIBHAR_01767	hypothetical protein
Position: -35 Score: 5.7 Sequence: AAATAATAATGATTCTCACTA Locus tag: VSAL_I2257 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: VSAL_I2258 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: VSAL_I2259 Name: feoC Funciton: Ferrous iron transport protein C
	VSAL_I2257	feoA	Ferrous iron transport protein A
	VSAL_I2258	feoB	Ferrous iron transport protein B
	VSAL_I2259	feoC	Ferrous iron transport protein C
Position: -50 Score: 5.4 Sequence: AATTGATATAAGTTCTCATTT Locus tag: VSAL_I0884 Name: null Funciton: hypothetical protein
	VSAL_I0884		hypothetical protein
Position: -256 Score: 4.9 Sequence: CGATAAGAATCATTATCACTT Locus tag: VSAL_I2788 Name: frdA Funciton: fumarate reductase, flavoprotein subunit Locus tag: VSAL_I2789 Name: frdB Funciton: fumarate reductase, iron-sulfur protein Locus tag: VSAL_I2790 Name: frdC Funciton: fumarate reductase, 15 kDa hydrophobic protein Locus tag: VSAL_I2791 Name: frdD Funciton: fumarate reductase, 13 kDa hydrophobic protein
	VSAL_I2788	frdA	fumarate reductase, flavoprotein subunit
	VSAL_I2789	frdB	fumarate reductase, iron-sulfur protein
	VSAL_I2790	frdC	fumarate reductase, 15 kDa hydrophobic protein
	VSAL_I2791	frdD	fumarate reductase, 13 kDa hydrophobic protein
Position: -72 Score: 4.6 Sequence: AAATGATAGTTGATAATAATT Position: -65 Score: 5.8 Sequence: AGTTGATAATAATTCTCATTT Position: -39 Score: 5.3 Sequence: TACTAATAATCATTCGCATTT Locus tag: VSAL_II0074 Name: PF11449 Funciton: Predicted manganese transporter, 11 TMS
	VSAL_II0074	PF11449	Predicted manganese transporter, 11 TMS

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Vibrio salmonicida LFI1238

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --