Regulon of Fur in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type:	Transcription factor
TF locus tag:	VIBHAR_01339
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Vibrionales
Statistics of regulated genes:
- Genes	94
- Operons	45
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 447 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -134 Score: 5.2 Sequence: AAATGATAATTATTGATATTT Locus tag: VIBHAR_01762 Name: viuA Funciton: Ferric aerobactin receptor, TonB-dependent
	VIBHAR_01762	viuA	Ferric aerobactin receptor, TonB-dependent
Position: -154 Score: 5.3 Sequence: TATTGCTAATCATTATCAACT Position: -109 Score: 5.6 Sequence: AAATAAGATCAATTATCAATT Locus tag: VIBHAR_05245 Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake Locus tag: VIBHAR_05246 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: VIBHAR_05247 Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
	VIBHAR_05245	hutW	Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
	VIBHAR_05246	huvX	Putative heme iron utilization protein
	VIBHAR_05247	hutZ	Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
Position: -69 Score: 4.6 Sequence: TATTGTAAATGATTATTGTTT Position: -63 Score: 4.4 Sequence: AAATGATTATTGTTTGCAAAA Locus tag: VIBHAR_02101 Name: vibF Funciton: nonribosomal peptide synthetase VibF
	VIBHAR_02101	vibF	nonribosomal peptide synthetase VibF
Position: -311 Score: 6 Sequence: AATTAATAATAATTCTCATTT Position: -305 Score: 4.4 Sequence: TAATAATTCTCATTTTCAATA Locus tag: VIBHAR_06129 Name: VCA0743 Funciton: uroporphyrinogen decarboxylase
	VIBHAR_06129	VCA0743	uroporphyrinogen decarboxylase
Position: -57 Score: 5.5 Sequence: AGTTGATAATGATTTTCATTA Position: -51 Score: 4.8 Sequence: TAATGATTTTCATTAACATTA Locus tag: VIBHAR_00151 Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
	VIBHAR_00151	sodA	Manganese superoxide dismutase (EC 1.15.1.1)
Position: -57 Score: 5.5 Sequence: TATTGAGATTTATTATCATCT Locus tag: VIBHAR_00267 Name: COG3315 Funciton: O-Methyltransferase involved in polyketide biosynthesis
	VIBHAR_00267	COG3315	O-Methyltransferase involved in polyketide biosynthesis
Position: -60 Score: 6 Sequence: TAATGATAATAATTCTCAATA Locus tag: VIBHAR_03638 Name: VC0426 Funciton: Predicted membrane protein
	VIBHAR_03638	VC0426	Predicted membrane protein
Position: -65 Score: 5.4 Sequence: AACTGAGAATCATTATTAATA Locus tag: VIBHAR_00368 Name: COG2132 Funciton: Multicopper oxidase
	VIBHAR_00368	COG2132	Multicopper oxidase
Position: -81 Score: 5.2 Sequence: GAATGATAGTAATTACCATTT Locus tag: VIBHAR_05789 Name: hutA Funciton: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
	VIBHAR_05789	hutA	TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
Position: -73 Score: 4.8 Sequence: AAATGAAAACAAGTCGCACTT Position: -50 Score: 5.8 Sequence: AATTGATAATTAATTTCATTT Locus tag: VIBHAR_05095 Name: VV20793 Funciton: Conserved hypothetical protein Locus tag: VIBHAR_05094 Name: VV20794 Funciton: ABC transporter, ATP-binding protein
	VIBHAR_05095	VV20793	Conserved hypothetical protein
	VIBHAR_05094	VV20794	ABC transporter, ATP-binding protein
Position: -2 Score: 4.9 Sequence: AAATGAGAATTAGTTTCGTTA Locus tag: VIBHAR_06301 Name: null Funciton: hypothetical protein Locus tag: VIBHAR_06300 Name: VV21338 Funciton: HTH-type transcription regulator, AraC-family
	VIBHAR_06301		hypothetical protein
	VIBHAR_06300	VV21338	HTH-type transcription regulator, AraC-family
Position: -111 Score: 5.1 Sequence: AAATGATAATTAATCCTATCA Locus tag: VIBHAR_02109 Name: VV20830 Funciton: Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific
	VIBHAR_02109	VV20830	Non-ribosomal peptide synthetase modules, siderophore biosynthesis # vulnibactin-specific
Position: -197 Score: 4.6 Sequence: CAATGTAAATGGTTCTCAATT Locus tag: VIBHAR_06272 Name: VV20568 Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: VIBHAR_06271 Name: VV20567 Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: VIBHAR_06270 Name: VV20566 Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: VIBHAR_06269 Name: VV20565 Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
	VIBHAR_06272	VV20568	Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
	VIBHAR_06271	VV20567	Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
	VIBHAR_06270	VV20566	Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
	VIBHAR_06269	VV20565	Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
Position: -58 Score: 5.3 Sequence: ACTTGATAATAATTATCGTTT Locus tag: VIBHAR_02989 Name: PF10952 Funciton: Protein of unknown function (DUF2753)
	VIBHAR_02989	PF10952	Protein of unknown function (DUF2753)
Position: -41 Score: 5.7 Sequence: AATTGATAATGATTTTCAATA Position: -35 Score: 5 Sequence: TAATGATTTTCAATATCAATT Locus tag: VIBHAR_03036 Name: null Funciton: hypothetical protein Locus tag: VIBHAR_03037 Name: PF00106 Funciton: Short chain dehydrogenase
	VIBHAR_03036		hypothetical protein
	VIBHAR_03037	PF00106	Short chain dehydrogenase
Position: -119 Score: 4.6 Sequence: TAATGCGAGTGATAATTATTA Position: -113 Score: 5 Sequence: GAGTGATAATTATTATCAAAA Position: -50 Score: 5.3 Sequence: AAATGAGAAGGGATCTCATTT Locus tag: VIBHAR_01398 Name: VC0773 Funciton: Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific Locus tag: VIBHAR_01399 Name: VC0772 Funciton: 2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE
	VIBHAR_01398	VC0773	Isochorismate synthase (EC 5.4.4.2) of siderophore biosynthesis # Vibriobactin-specific
	VIBHAR_01399	VC0772	2,3-dihydroxybenzoate-AMP ligase (EC 2.7.7.58) # Vibriobactin-specific, VibE
Position: -46 Score: 4.5 Sequence: TGATGTAAAGTATTCTCATTA Locus tag: VIBHAR_02532 Name: COG2910 Funciton: Putative NADH-flavin reductase
	VIBHAR_02532	COG2910	Putative NADH-flavin reductase
Position: -42 Score: 5.7 Sequence: TAATAATAATATTTATCATTA Locus tag: VIBHAR_01363 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: VIBHAR_01364 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: VIBHAR_01365 Name: feoC Funciton: Ferrous iron transport protein C
	VIBHAR_01363	feoA	Ferrous iron transport protein A
	VIBHAR_01364	feoB	Ferrous iron transport protein B
	VIBHAR_01365	feoC	Ferrous iron transport protein C
Position: -48 Score: 5.6 Sequence: AAATGAGATTTATTACTATTT Locus tag: VIBHAR_06299 Name: fhuA Funciton: TonB-dependent outer membrane receptor for iron siderophores Locus tag: VIBHAR_06298 Name: fhuD Funciton: Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3) Locus tag: VIBHAR_06297 Name: fhuB Funciton: Ferrichrome transport system permease protein FhuB
	VIBHAR_06299	fhuA	TonB-dependent outer membrane receptor for iron siderophores
	VIBHAR_06298	fhuD	Ferrichrome-binding periplasmic protein precursor (TC 3.A.1.14.3)
	VIBHAR_06297	fhuB	Ferrichrome transport system permease protein FhuB
Position: -95 Score: 5 Sequence: TATTGATATTACTTCTCAGTT Locus tag: VIBHAR_06007 Name: fepB Funciton: ABC-type Fe3+-siderophores transport systems, periplasmic component Locus tag: VIBHAR_06008 Name: fepD Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: VIBHAR_06009 Name: fepD Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: VIBHAR_06010 Name: fepC Funciton: ABC-type Fe3+-siderophores transport system, ATPase component Locus tag: VIBHAR_06011 Name: fepA Funciton: TonB-dependent ferric achromobactin receptor
	VIBHAR_06007	fepB	ABC-type Fe3+-siderophores transport systems, periplasmic component
	VIBHAR_06008	fepD	ABC-type Fe3+-siderophore transport system, permease component
	VIBHAR_06009	fepD	ABC-type Fe3+-siderophore transport system, permease component
	VIBHAR_06010	fepC	ABC-type Fe3+-siderophores transport system, ATPase component
	VIBHAR_06011	fepA	TonB-dependent ferric achromobactin receptor
Position: -24 Score: 4.9 Sequence: TAATAGGACTTATTCTCAATT Locus tag: VIBHAR_02349 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component
	VIBHAR_02349	VV1_2646	ABC-type multidrug transport system, ATPase and permease component
Position: -51 Score: 5.5 Sequence: AAATAAGAATAATTAGCACTA Locus tag: VIBHAR_02715 Name: irpA Funciton: Iron-regulated protein A precursor
	VIBHAR_02715	irpA	Iron-regulated protein A precursor
Position: -118 Score: 5.2 Sequence: AAATAAGAATTGATGTCATTT Position: -46 Score: 5.9 Sequence: AATTGAGAATAGTTATCAATT Locus tag: VIBHAR_02726 Name: nrfB Funciton: Cytochrome c-type protein NrfB precursor Locus tag: VIBHAR_02725 Name: nfrC Funciton: Putative nitrite reductase, Fe-S protein (NrfC) Locus tag: VIBHAR_02724 Name: nfrC Funciton: Putative nitrite reductase, Fe-S protein (NrfC) Locus tag: VIBHAR_02723 Name: nrfD Funciton: Putative nitrate reductase, formate dependent (NrfD)
	VIBHAR_02726	nrfB	Cytochrome c-type protein NrfB precursor
	VIBHAR_02725	nfrC	Putative nitrite reductase, Fe-S protein (NrfC)
	VIBHAR_02724	nfrC	Putative nitrite reductase, Fe-S protein (NrfC)
	VIBHAR_02723	nrfD	Putative nitrate reductase, formate dependent (NrfD)
Position: -80 Score: 5.9 Sequence: AAATGATAATTGATCTCATTT Locus tag: VIBHAR_05127 Name: ptrB Funciton: Protease II (EC 3.4.21.83) Locus tag: VIBHAR_05128 Name: hutR Funciton: TonB-dependent heme receptor HutR Locus tag: VIBHAR_05129 Name: null Funciton: hypothetical protein Locus tag: VIBHAR_05130 Name: null Funciton: hypothetical protein Locus tag: VIBHAR_05131 Name: VCA0065 Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Locus tag: VIBHAR_05132 Name: VCA0065 Funciton: Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase Locus tag: VIBHAR_05133 Name: VCA0066 Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog Locus tag: VIBHAR_05134 Name: VCA0066 Funciton: Hypothetical protein in cluster with HutR, VCA0066 homolog Locus tag: VIBHAR_05135 Name: VCA0067 Funciton: Hypothetical protein in cluster with HutR, VCA0067 homolog
	VIBHAR_05127	ptrB	Protease II (EC 3.4.21.83)
	VIBHAR_05128	hutR	TonB-dependent heme receptor HutR
	VIBHAR_05129		hypothetical protein
	VIBHAR_05130		hypothetical protein
	VIBHAR_05131	VCA0065	Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
	VIBHAR_05132	VCA0065	Hypothetical with regulatory P domain of a subtilisin-like proprotein convertase
	VIBHAR_05133	VCA0066	Hypothetical protein in cluster with HutR, VCA0066 homolog
	VIBHAR_05134	VCA0066	Hypothetical protein in cluster with HutR, VCA0066 homolog
	VIBHAR_05135	VCA0067	Hypothetical protein in cluster with HutR, VCA0067 homolog
Position: -79 Score: 5.6 Sequence: AATTGATAATTGATCTTATTT Position: -34 Score: 5.3 Sequence: AGTTGATAATGATTAGCAATA Locus tag: VIBHAR_05244 Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake Locus tag: VIBHAR_05243 Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake Locus tag: VIBHAR_05242 Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake Locus tag: VIBHAR_05241 Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein Locus tag: VIBHAR_05240 Name: hmuU Funciton: Hemin ABC transporter, permease component Locus tag: VIBHAR_05239 Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit
	VIBHAR_05244	tonB-hmu	Periplasmic protein TonB involved in hemin uptake
	VIBHAR_05243	exbB-hmu	TonB system transport protein ExbB involved in hemin uptake
	VIBHAR_05242	exbD-hmu	TonB system transport protein ExbD involved in hemin uptake
	VIBHAR_05241	hmuT	Hemin ABC transporter, periplasmic hemin-binding protein
	VIBHAR_05240	hmuU	Hemin ABC transporter, permease component
	VIBHAR_05239	hmuV	Hemin ABC transporter, ATP-binding subunit
Position: -191 Score: 5.9 Sequence: AAATGGTAATAATTCTCATTA Position: -165 Score: 5.5 Sequence: AAGTGAGAATTATTCGCAATA Locus tag: VIBHAR_01860 Name: ppaC Funciton: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
	VIBHAR_01860	ppaC	Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
Position: 4 Score: 4.4 Sequence: GAAAGAGAATTGTTATCAAAA Locus tag: VIBHAR_06920 Name: VIBHAR_06920 Funciton: Siderophore-interacting protein ViuB
	VIBHAR_06920	VIBHAR_06920	Siderophore-interacting protein ViuB
Position: -81 Score: 5.1 Sequence: AATTAATAATCATTCTCAAAA Locus tag: VIBHAR_03251 Name: null Funciton: hypothetical protein
	VIBHAR_03251		hypothetical protein
Position: 4 Score: 4.4 Sequence: GAAAGAGAATTGTTATCAAAA Locus tag: VIBHAR_06920 Name: viuB Funciton: Siderophore-interacting protein ViuB
	VIBHAR_06920	viuB	Siderophore-interacting protein ViuB
Position: -31 Score: 4.7 Sequence: GCATGATAACGGATCTCATTA Locus tag: VIBHAR_06135 Name: vctP Funciton: iron(III) ABC transporter, periplasmic iron-compound-binding protein Locus tag: VIBHAR_06134 Name: vctD Funciton: Iron(III) ABC transporter, permease protein Locus tag: VIBHAR_06133 Name: vctB Funciton: Iron(III) ABC transporter, permease protein Locus tag: VIBHAR_06132 Name: vctC Funciton: Iron(III) ABC transporter, ATP-binding protein
	VIBHAR_06135	vctP	iron(III) ABC transporter, periplasmic iron-compound-binding protein
	VIBHAR_06134	vctD	Iron(III) ABC transporter, permease protein
	VIBHAR_06133	vctB	Iron(III) ABC transporter, permease protein
	VIBHAR_06132	vctC	Iron(III) ABC transporter, ATP-binding protein
Position: -320 Score: 5.1 Sequence: TGATAGGATTAATTATCATTT Locus tag: VIBHAR_02108 Name: vctD Funciton: Iron(III) ABC transporter, permease protein Locus tag: VIBHAR_02107 Name: vctB Funciton: Iron(III) ABC transporter, permease protein
	VIBHAR_02108	vctD	Iron(III) ABC transporter, permease protein
	VIBHAR_02107	vctB	Iron(III) ABC transporter, permease protein
Position: -80 Score: 5.4 Sequence: TAACGCTAATTATTCTCATTA Locus tag: VIBHAR_03054 Name: COG3016 Funciton: Conserved hypothetical iron-regulated protein
	VIBHAR_03054	COG3016	Conserved hypothetical iron-regulated protein
Position: -173 Score: 5.2 Sequence: AAATGGTAATTACTATCATTC Locus tag: VIBHAR_05788 Name: VCA0575 Funciton: Transcriptional regulator, LysR family
	VIBHAR_05788	VCA0575	Transcriptional regulator, LysR family
Position: -41 Score: 6.1 Sequence: TATTGATAATAATTATCATTA Position: -38 Score: 4.5 Sequence: TGATAATAATTATCATTATCT Locus tag: VIBHAR_00162 Name: VC1572 Funciton: hypothetical protein Locus tag: VIBHAR_00163 Name: fumC Funciton: Fumarate hydratase class II (EC 4.2.1.2)
	VIBHAR_00162	VC1572	hypothetical protein
	VIBHAR_00163	fumC	Fumarate hydratase class II (EC 4.2.1.2)
Position: -78 Score: 5.5 Sequence: AACTAAGAATTATTATTATTA Locus tag: VIBHAR_00530 Name: VC0074 Funciton: conserved hypothetical protein
	VIBHAR_00530	VC0074	conserved hypothetical protein
Position: -97 Score: 5.4 Sequence: AAATGGTAATAGTTGTCATTT Locus tag: VIBHAR_06761 Name: fhuE Funciton: Putative ferrichrome-iron receptor Locus tag: VIBHAR_06760 Name: PF11932 Funciton: hypothetical protein Locus tag: VIBHAR_06759 Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein Locus tag: VIBHAR_06758 Name: exbB2 Funciton: TonB system transport protein ExbB2 Locus tag: VIBHAR_06757 Name: exbD2 Funciton: TonB system transport protein ExbD2 Locus tag: VIBHAR_06756 Name: tonB Funciton: Periplasmic protein TonB Locus tag: VIBHAR_06755 Name: VC1543 Funciton: TPR domain protein, putative component of TonB system
	VIBHAR_06761	fhuE	Putative ferrichrome-iron receptor
	VIBHAR_06760	PF11932	hypothetical protein
	VIBHAR_06759	exbB1	Biopolymer transport protein ExbB-related protein
	VIBHAR_06758	exbB2	TonB system transport protein ExbB2
	VIBHAR_06757	exbD2	TonB system transport protein ExbD2
	VIBHAR_06756	tonB	Periplasmic protein TonB
	VIBHAR_06755	VC1543	TPR domain protein, putative component of TonB system
Position: -46 Score: 5 Sequence: TAATGATAATGATAATGATTA Position: -40 Score: 5.7 Sequence: TAATGATAATGATTATCTTTT Locus tag: VIBHAR_07043 Name: VV21178 Funciton: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
	VIBHAR_07043	VV21178	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
Position: -41 Score: 5.3 Sequence: AACTGATAAACGTTATCATTA Locus tag: VIBHAR_03435 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VIBHAR_03434 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VIBHAR_03433 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	VIBHAR_03435	fbpA	Ferric iron ABC transporter, iron-binding protein
	VIBHAR_03434	fbpB	Ferric iron ABC transporter, permease protein
	VIBHAR_03433	fbpC	Ferric iron ABC transporter, ATP-binding protein
Position: -62 Score: 5.5 Sequence: TATTGCGAATAATTCTCACTT Position: -36 Score: 5.9 Sequence: TAATGAGAATTATTACCATTT Locus tag: VIBHAR_01859 Name: PF11449 Funciton: Predicted manganese transporter, 11 TMS
	VIBHAR_01859	PF11449	Predicted manganese transporter, 11 TMS
Position: -66 Score: 5.3 Sequence: AGGTGATATTGATTCTCATTT Locus tag: VIBHAR_04897 Name: mntH Funciton: Manganese transport protein MntH
	VIBHAR_04897	mntH	Manganese transport protein MntH
Position: -93 Score: 4.6 Sequence: AATTGAGAACCATTTACATTG Locus tag: VIBHAR_06273 Name: VCA1041 Funciton: Phosphomannomutase
	VIBHAR_06273	VCA1041	Phosphomannomutase
Position: -2 Score: 5.3 Sequence: AAATGATAATAGTTATAATCT Locus tag: VIBHAR_05136 Name: torS Funciton: Methyl-accepting chemotaxis protein
	VIBHAR_05136	torS	Methyl-accepting chemotaxis protein
Position: -29 Score: 5.2 Sequence: AAATATCAATAATTATCATTT Locus tag: VIBHAR_01763 Name: VIBHAR_01763 Funciton: Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1) Locus tag: VIBHAR_01766 Name: VIBHAR_01766 Funciton: Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3) Locus tag: VIBHAR_01767 Name: VIBHAR_01767 Funciton: hypothetical protein
	VIBHAR_01763	VIBHAR_01763	Iron(III) dicitrate transport system, periplasmic iron-binding protein FecB (TC 3.A.1.14.1)
	VIBHAR_01766	VIBHAR_01766	Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3)
	VIBHAR_01767	VIBHAR_01767	hypothetical protein
Position: -48 Score: 4.9 Sequence: AATTGATATACATTCTCTTTT Locus tag: VIBHAR_06888 Name: null Funciton: hypothetical protein
	VIBHAR_06888		hypothetical protein
Position: -58 Score: 4.5 Sequence: TAACAAGAACGATTCTTGTTT Locus tag: VIBHAR_00053 Name: bfd Funciton: Bacterioferritin-associated ferredoxin Locus tag: VIBHAR_00052 Name: bfr Funciton: Bacterioferritin
	VIBHAR_00053	bfd	Bacterioferritin-associated ferredoxin
	VIBHAR_00052	bfr	Bacterioferritin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Vibrio harveyi ATCC BAA-1116

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --