Regulon of Fur in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_10628
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Vibrionales
Statistics of regulated genes:
- Genes	67
- Operons	37
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 447 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 5.1 Sequence: GATTGAGAACAGTTCTCACTT Locus tag: VSAK1_03499 Name: COG0778 Funciton: Nitroreductase
	VSAK1_03499	COG0778	Nitroreductase
Position: -73 Score: 5.1 Sequence: AAATGATAATTACTTGCATTC Locus tag: VSAK1_17632 Name: VV20793 Funciton: Conserved hypothetical protein Locus tag: VSAK1_17627 Name: VV20794 Funciton: ABC transporter, ATP-binding protein
	VSAK1_17632	VV20793	Conserved hypothetical protein
	VSAK1_17627	VV20794	ABC transporter, ATP-binding protein
Position: -2 Score: 5.5 Sequence: AAATGACATTAGTTATCATTT Locus tag: VSAK1_13246 Name: COG3315 Funciton: O-Methyltransferase involved in polyketide biosynthesis
	VSAK1_13246	COG3315	O-Methyltransferase involved in polyketide biosynthesis
Position: -70 Score: 4.9 Sequence: GATTGATTTTAATTCTCATTA Locus tag: VSAK1_10253 Name: VC0426 Funciton: Predicted membrane protein
	VSAK1_10253	VC0426	Predicted membrane protein
Position: -44 Score: 4.8 Sequence: AATTGAGAATCATTATCTAAT Locus tag: VSAK1_24319 Name: COG2132 Funciton: Multicopper oxidase
	VSAK1_24319	COG2132	Multicopper oxidase
Position: -241 Score: 5.7 Sequence: AAATGATAATTAATATCATCA Locus tag: VSAK1_05600 Name: nrfA Funciton: Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
	VSAK1_05600	nrfA	Formate-dependent nitrite reductase, periplasmic cytochrome c552 subunit
Position: -148 Score: 5 Sequence: AAATGATAATCGTTATCGAAT Position: -55 Score: 5.7 Sequence: AAATGATAATCAATATCATCT Locus tag: VSAK1_20819 Name: PF10952 Funciton: Protein of unknown function (DUF2753)
	VSAK1_20819	PF10952	Protein of unknown function (DUF2753)
Position: -84 Score: 5.5 Sequence: AAATAATAATACATATCATTT Locus tag: VSAK1_23799 Name: hutA Funciton: TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
	VSAK1_23799	hutA	TonB-dependent heme and hemoglobin receptor HutA ; TonB-dependent hemin , ferrichrome receptor
Position: -63 Score: 5.1 Sequence: CATTGAGAATTATTCTCATAT Position: -37 Score: 6.3 Sequence: TAATGATAATAATTCTCATTT Locus tag: VSAK1_04382 Name: PF11449 Funciton: Predicted manganese transporter, 11 TMS
	VSAK1_04382	PF11449	Predicted manganese transporter, 11 TMS
Position: -98 Score: 4.4 Sequence: TAATGATATTGAGAGTCATTT Locus tag: VSAK1_17622 Name: VCA1041 Funciton: Phosphomannomutase
	VSAK1_17622	VCA1041	Phosphomannomutase
Position: -45 Score: 5.2 Sequence: TAATGTTAATATTTCTCATTA Locus tag: VSAK1_09003 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: VSAK1_09008 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: VSAK1_09013 Name: feoC Funciton: Ferrous iron transport protein C
	VSAK1_09003	feoA	Ferrous iron transport protein A
	VSAK1_09008	feoB	Ferrous iron transport protein B
	VSAK1_09013	feoC	Ferrous iron transport protein C
Position: -107 Score: 5.6 Sequence: AAATAAGATCAATTATCAATT Locus tag: VSAK1_22234 Name: hutW Funciton: Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake Locus tag: VSAK1_22239 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: VSAK1_22244 Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
	VSAK1_22234	hutW	Radical SAM family protein HutW, similar to coproporphyrinogen III oxidase, oxygen-independent, associated with heme uptake
	VSAK1_22239	huvX	Putative heme iron utilization protein
	VSAK1_22244	hutZ	Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
Position: -225 Score: 5.3 Sequence: AAATGATAACTCATATCAATA Locus tag: VSAK1_26760 Name: PF11932 Funciton: hypothetical protein Locus tag: VSAK1_26755 Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein Locus tag: VSAK1_26750 Name: exbB2 Funciton: TonB system transport protein ExbB2 Locus tag: VSAK1_26745 Name: exbD2 Funciton: TonB system transport protein ExbD2 Locus tag: VSAK1_26740 Name: tonB Funciton: Periplasmic protein TonB Locus tag: VSAK1_26735 Name: VC1543 Funciton: TPR domain protein, putative component of TonB system
	VSAK1_26760	PF11932	hypothetical protein
	VSAK1_26755	exbB1	Biopolymer transport protein ExbB-related protein
	VSAK1_26750	exbB2	TonB system transport protein ExbB2
	VSAK1_26745	exbD2	TonB system transport protein ExbD2
	VSAK1_26740	tonB	Periplasmic protein TonB
	VSAK1_26735	VC1543	TPR domain protein, putative component of TonB system
Position: -40 Score: 5.5 Sequence: AAATGATATTTATTTGCAATT Position: -23 Score: 4.6 Sequence: AATTGATTCTAATTTGCATTT Locus tag: VSAK1_06125 Name: VV20793 Funciton: Conserved hypothetical protein
	VSAK1_06125	VV20793	Conserved hypothetical protein
Position: -42 Score: 4.8 Sequence: TATTAATAATAAAACTTATTA Locus tag: VSAK1_16967 Name: null Funciton: outer membrane protein OmpU
	VSAK1_16967		outer membrane protein OmpU
Position: -24 Score: 5.1 Sequence: TAGTGTAAATTATTATCATTA Position: -18 Score: 4.6 Sequence: AAATTATTATCATTATCAATG Locus tag: VSAK1_01252 Name: COG2910 Funciton: Putative NADH-flavin reductase
	VSAK1_01252	COG2910	Putative NADH-flavin reductase
Position: -69 Score: 5.2 Sequence: TATTGATAACTATTATCAAAA Locus tag: VSAK1_22009 Name: fepA Funciton: TonB-dependent ferric achromobactin receptor
	VSAK1_22009	fepA	TonB-dependent ferric achromobactin receptor
Position: -76 Score: 4.4 Sequence: TAATAGTATTGATAACCATTA Position: -70 Score: 5.3 Sequence: TATTGATAACCATTATTGTTT Locus tag: VSAK1_22029 Name: fepB Funciton: ABC-type Fe3+-siderophores transport systems, periplasmic component Locus tag: VSAK1_22024 Name: fepD Funciton: ABC-type Fe3+-siderophore transport system, permease component
	VSAK1_22029	fepB	ABC-type Fe3+-siderophores transport systems, periplasmic component
	VSAK1_22024	fepD	ABC-type Fe3+-siderophore transport system, permease component
Position: -52 Score: 5.5 Sequence: AAATGAAAGTAATTATCAATA Position: -46 Score: 4.4 Sequence: AAGTAATTATCAATAACATTT Locus tag: VSAK1_26775 Name: null Funciton: ferrichrome-iron receptor Locus tag: VSAK1_26770 Name: null Funciton: ferrichrome-iron receptor Locus tag: VSAK1_26765 Name: null Funciton: hypothetical protein
	VSAK1_26775		ferrichrome-iron receptor
	VSAK1_26770		ferrichrome-iron receptor
	VSAK1_26765		hypothetical protein
Position: -47 Score: 4.5 Sequence: AACTAAGAATCATTCCTGTTT Locus tag: VSAK1_12905 Name: VC0074 Funciton: conserved hypothetical protein
	VSAK1_12905	VC0074	conserved hypothetical protein
Position: -23 Score: 4.6 Sequence: TAATAGGAACTATTCTCAAAA Locus tag: VSAK1_05315 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VSAK1_05320 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VSAK1_05325 Name: pqiB Funciton: Paraquat-inducible protein B
	VSAK1_05315	VV1_2646	ABC-type multidrug transport system, ATPase and permease component
	VSAK1_05320	pqiA	Paraquat-inducible protein A
	VSAK1_05325	pqiB	Paraquat-inducible protein B
Position: -79 Score: 5.6 Sequence: AAATGATATTGATTCCCATTT Position: -52 Score: 4.7 Sequence: AAGTGATAATGATTCTGTTTA Locus tag: VSAK1_21214 Name: vctP Funciton: iron(III) ABC transporter, periplasmic iron-compound-binding protein Locus tag: VSAK1_21219 Name: vctD Funciton: Iron(III) ABC transporter, permease protein Locus tag: VSAK1_21224 Name: vctB Funciton: Iron(III) ABC transporter, permease protein Locus tag: VSAK1_21229 Name: vctC Funciton: Iron(III) ABC transporter, ATP-binding protein
	VSAK1_21214	vctP	iron(III) ABC transporter, periplasmic iron-compound-binding protein
	VSAK1_21219	vctD	Iron(III) ABC transporter, permease protein
	VSAK1_21224	vctB	Iron(III) ABC transporter, permease protein
	VSAK1_21229	vctC	Iron(III) ABC transporter, ATP-binding protein
Position: -78 Score: 5.6 Sequence: AATTGATAATTGATCTTATTT Locus tag: VSAK1_22229 Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake Locus tag: VSAK1_22224 Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake Locus tag: VSAK1_22219 Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake Locus tag: VSAK1_22214 Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake Locus tag: VSAK1_22209 Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein Locus tag: VSAK1_22204 Name: hmuU Funciton: Hemin ABC transporter, permease component Locus tag: VSAK1_22199 Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit
	VSAK1_22229	tonB-hmu	Periplasmic protein TonB involved in hemin uptake
	VSAK1_22224	tonB-hmu	Periplasmic protein TonB involved in hemin uptake
	VSAK1_22219	exbB-hmu	TonB system transport protein ExbB involved in hemin uptake
	VSAK1_22214	exbD-hmu	TonB system transport protein ExbD involved in hemin uptake
	VSAK1_22209	hmuT	Hemin ABC transporter, periplasmic hemin-binding protein
	VSAK1_22204	hmuU	Hemin ABC transporter, permease component
	VSAK1_22199	hmuV	Hemin ABC transporter, ATP-binding subunit
Position: -192 Score: 6.3 Sequence: AAATGAGAATTATTATCATTA Position: -166 Score: 5.1 Sequence: ATATGAGAATAATTCTCAATG Locus tag: VSAK1_04387 Name: ppaC Funciton: Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
	VSAK1_04387	ppaC	Manganese-dependent inorganic pyrophosphatase (EC 3.6.1.1)
Position: -112 Score: 5.9 Sequence: AAATAGTAATAATTATCATTT Locus tag: VSAK1_20974 Name: iutA Funciton: Aerobactin siderophore receptor IutA,TonB-dependent
	VSAK1_20974	iutA	Aerobactin siderophore receptor IutA,TonB-dependent
Position: -108 Score: 4.6 Sequence: AGATGAAAATAATTGCCACTA Position: -77 Score: 5.4 Sequence: AAATGATAGTAATTCGTATTT Locus tag: VSAK1_14737 Name: VSAK1_14737 Funciton: TonB-dependent hemin , ferrichrome receptor Locus tag: VSAK1_14742 Name: VCA0575 Funciton: Transcriptional regulator, LysR family
	VSAK1_14737	VSAK1_14737	TonB-dependent hemin , ferrichrome receptor
	VSAK1_14742	VCA0575	Transcriptional regulator, LysR family
Position: -274 Score: 5.7 Sequence: TGATGATATTAATTATCATTT Position: -125 Score: 4.9 Sequence: AAATAAGAATTGATTACATTT Locus tag: VSAK1_05595 Name: nrfB Funciton: Cytochrome c-type protein NrfB precursor Locus tag: VSAK1_05590 Name: nfrC Funciton: Putative nitrite reductase, Fe-S protein (NrfC) Locus tag: VSAK1_05585 Name: nrfD Funciton: Putative nitrate reductase, formate dependent (NrfD)
	VSAK1_05595	nrfB	Cytochrome c-type protein NrfB precursor
	VSAK1_05590	nfrC	Putative nitrite reductase, Fe-S protein (NrfC)
	VSAK1_05585	nrfD	Putative nitrate reductase, formate dependent (NrfD)
Position: -31 Score: 5.4 Sequence: AAATGAAAACAATAATCATTA Locus tag: VSAK1_05955 Name: viuB Funciton: Siderophore-interacting protein ViuB
	VSAK1_05955	viuB	Siderophore-interacting protein ViuB
Position: -31 Score: 5.4 Sequence: AAATGAAAACAATAATCATTA Locus tag: VSAK1_05955 Name: VIBHAR_06920 Funciton: Siderophore-interacting protein ViuB
	VSAK1_05955	VIBHAR_06920	Siderophore-interacting protein ViuB
Position: -102 Score: 5.8 Sequence: AAATGATAATAGTTTGCATTT Locus tag: VSAK1_03314 Name: null Funciton: putative transcriptional regulator, AraC/XylS family protein
	VSAK1_03314		putative transcriptional regulator, AraC/XylS family protein
Position: -67 Score: 5.4 Sequence: AGATGCGATTGATTATCATTT Locus tag: VSAK1_15507 Name: mntH Funciton: Manganese transport protein MntH
	VSAK1_15507	mntH	Manganese transport protein MntH
Position: -55 Score: 5.7 Sequence: AAATGATAATAATTCGCACTA Locus tag: VSAK1_04580 Name: irpA Funciton: Iron-regulated protein A precursor
	VSAK1_04580	irpA	Iron-regulated protein A precursor
Position: -78 Score: 6.3 Sequence: TAATGATAATGATTATCATTT Position: -72 Score: 4.5 Sequence: TAATGATTATCATTTTAATCT Locus tag: VSAK1_18252 Name: null Funciton: TonB-dependent heme receptor
	VSAK1_18252		TonB-dependent heme receptor
Position: -39 Score: 5.8 Sequence: AAATGCAAACTATTATCATTT Locus tag: VSAK1_03309 Name: COG4771 Funciton: Outer membrane receptor for ferrienterochelin, TonB-dependent
	VSAK1_03309	COG4771	Outer membrane receptor for ferrienterochelin, TonB-dependent
Position: -256 Score: 4.9 Sequence: AAATCATAATTAAACTCATTA Locus tag: VSAK1_11298 Name: frdA Funciton: fumarate reductase, flavoprotein subunit Locus tag: VSAK1_11293 Name: frdB Funciton: fumarate reductase, iron-sulfur protein Locus tag: VSAK1_11288 Name: frdC Funciton: fumarate reductase, 15 kDa hydrophobic protein Locus tag: VSAK1_11283 Name: frdD Funciton: fumarate reductase, 13 kDa hydrophobic protein
	VSAK1_11298	frdA	fumarate reductase, flavoprotein subunit
	VSAK1_11293	frdB	fumarate reductase, iron-sulfur protein
	VSAK1_11288	frdC	fumarate reductase, 15 kDa hydrophobic protein
	VSAK1_11283	frdD	fumarate reductase, 13 kDa hydrophobic protein
Position: -64 Score: 5.6 Sequence: TAATGACAATAGTTATCATTA Locus tag: VSAK1_18187 Name: VSAK1_18187 Funciton: TonB-dependent receptor
	VSAK1_18187	VSAK1_18187	TonB-dependent receptor
Position: -108 Score: 5.8 Sequence: AAATGATAATAAATAGCATTA Locus tag: VSAK1_04950 Name: VSAK1_04950 Funciton: TonB-dependent siderophore receptor
	VSAK1_04950	VSAK1_04950	TonB-dependent siderophore receptor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Vibrio shilonii AK1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --