Regulon of Fur in Vibrio angustum S14

Properties
Regulator type:	Transcription factor
TF locus tag:	VAS14_17676
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Vibrionales
Statistics of regulated genes:
- Genes	64
- Operons	28
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 447 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -30 Score: 5.3 Sequence: AAAAAATAACTATTTTCATTT Locus tag: VAS14_05758 Name: COG0778 Funciton: Nitroreductase
	VAS14_05758	COG0778	Nitroreductase
Position: -74 Score: 5.3 Sequence: TAATGATTACCATTCTCATTA Locus tag: VAS14_08970 Name: null Funciton: outer membrane protein OmpU
	VAS14_08970		outer membrane protein OmpU
Position: -206 Score: 5.4 Sequence: GAATAATATCAATTATCATTT Locus tag: VAS14_03953 Name: huvX Funciton: Putative heme iron utilization protein Locus tag: VAS14_03948 Name: hutZ Funciton: Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
	VAS14_03953	huvX	Putative heme iron utilization protein
	VAS14_03948	hutZ	Pyridoxamine 5'-phosphate oxidase-related putative heme iron utilization protein # hutZ
Position: -89 Score: 6.1 Sequence: TATTGATAATAATTATCAATT Position: -83 Score: 4.8 Sequence: TAATAATTATCAATTGCATTT Locus tag: VAS14_10539 Name: sitA Funciton: Manganese ABC transporter, periplasmic-binding protein SitA Locus tag: VAS14_10534 Name: sitB Funciton: Manganese ABC transporter, ATP-binding protein SitB Locus tag: VAS14_10529 Name: sitC Funciton: Manganese ABC transporter, inner membrane permease protein SitC Locus tag: VAS14_10524 Name: sitD Funciton: Manganese ABC transporter, inner membrane permease protein SitD
	VAS14_10539	sitA	Manganese ABC transporter, periplasmic-binding protein SitA
	VAS14_10534	sitB	Manganese ABC transporter, ATP-binding protein SitB
	VAS14_10529	sitC	Manganese ABC transporter, inner membrane permease protein SitC
	VAS14_10524	sitD	Manganese ABC transporter, inner membrane permease protein SitD
Position: -42 Score: 5.7 Sequence: AACTGATAATTATTATCATCT Locus tag: VAS14_21832 Name: COG3315 Funciton: O-Methyltransferase involved in polyketide biosynthesis
	VAS14_21832	COG3315	O-Methyltransferase involved in polyketide biosynthesis
Position: -61 Score: 5.2 Sequence: CAATAAGAACGATTATCAATT Locus tag: VAS14_12444 Name: PF03929 Funciton: Uncharacterized protein involved in iron uptake Locus tag: VAS14_12439 Name: PF10029 Funciton: Predicted periplasmic protein (DUF2271) Locus tag: VAS14_12434 Name: cbiM Funciton: ABC-type Co2+ transport system, periplasmic component Locus tag: VAS14_12429 Name: VIBHAR_06747 Funciton: conserved hypothetical protein Locus tag: VAS14_12424 Name: VIBHAR_06746 Funciton: conserved hypothetical protein Locus tag: VAS14_12419 Name: PF01297 Funciton: ABC transporter, metal-binding lipoprotein Locus tag: VAS14_12414 Name: COG1121 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: VAS14_12409 Name: COG1108 Funciton: ABC-type Mn2+/Zn2+ transport systems, permease components Locus tag: VAS14_12404 Name: COG0803 Funciton: ABC-type metal ion transport system, periplasmic component/surface adhesin
	VAS14_12444	PF03929	Uncharacterized protein involved in iron uptake
	VAS14_12439	PF10029	Predicted periplasmic protein (DUF2271)
	VAS14_12434	cbiM	ABC-type Co2+ transport system, periplasmic component
	VAS14_12429	VIBHAR_06747	conserved hypothetical protein
	VAS14_12424	VIBHAR_06746	conserved hypothetical protein
	VAS14_12419	PF01297	ABC transporter, metal-binding lipoprotein
	VAS14_12414	COG1121	ABC-type Mn/Zn transport systems, ATPase component
	VAS14_12409	COG1108	ABC-type Mn2+/Zn2+ transport systems, permease components
	VAS14_12404	COG0803	ABC-type metal ion transport system, periplasmic component/surface adhesin
Position: -53 Score: 5.4 Sequence: TAATGATAATAAGTTTCATTA Position: -47 Score: 4.7 Sequence: TAATAAGTTTCATTATCATGT Locus tag: VAS14_10859 Name: VV21178 Funciton: ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component Locus tag: VAS14_10854 Name: VV21177 Funciton: ABC-type oligopeptide transport system, ATPase component Locus tag: VAS14_10849 Name: VCA0003 Funciton: Conesrved hypothetical protein
	VAS14_10859	VV21178	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component
	VAS14_10854	VV21177	ABC-type oligopeptide transport system, ATPase component
	VAS14_10849	VCA0003	Conesrved hypothetical protein
Position: -55 Score: 6.1 Sequence: TAATGATAATAGTTATCATTA Locus tag: VAS14_05603 Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1) Locus tag: VAS14_05608 Name: PF10952 Funciton: Protein of unknown function (DUF2753)
	VAS14_05603	sodA	Manganese superoxide dismutase (EC 1.15.1.1)
	VAS14_05608	PF10952	Protein of unknown function (DUF2753)
Position: -61 Score: 5.6 Sequence: AAATGACATTGATTATCATTT Locus tag: VAS14_12039 Name: mntH Funciton: Manganese transport protein MntH
	VAS14_12039	mntH	Manganese transport protein MntH
Position: -46 Score: 5.6 Sequence: TATTGAGAAACATTATCATTA Locus tag: VAS14_20031 Name: fbpA Funciton: Ferric iron ABC transporter, iron-binding protein Locus tag: VAS14_20036 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein Locus tag: VAS14_20041 Name: fbpC Funciton: Ferric iron ABC transporter, ATP-binding protein
	VAS14_20031	fbpA	Ferric iron ABC transporter, iron-binding protein
	VAS14_20036	fbpB	Ferric iron ABC transporter, permease protein
	VAS14_20041	fbpC	Ferric iron ABC transporter, ATP-binding protein
Position: -123 Score: 5.5 Sequence: TAATGCGAATGTTTATCATTT Locus tag: VAS14_13784 Name: VCA1041 Funciton: Phosphomannomutase
	VAS14_13784	VCA1041	Phosphomannomutase
Position: -189 Score: 5.5 Sequence: AAATGGTAATGGTTATCACTT Locus tag: VAS14_12509 Name: fhuE Funciton: Putative ferrichrome-iron receptor Locus tag: VAS14_12504 Name: PF11932 Funciton: hypothetical protein Locus tag: VAS14_12499 Name: exbB1 Funciton: Biopolymer transport protein ExbB-related protein Locus tag: VAS14_12494 Name: exbB2 Funciton: TonB system transport protein ExbB2 Locus tag: VAS14_12489 Name: exbD2 Funciton: TonB system transport protein ExbD2 Locus tag: VAS14_12484 Name: tonB Funciton: Periplasmic protein TonB Locus tag: VAS14_12479 Name: VC1543 Funciton: TPR domain protein, putative component of TonB system
	VAS14_12509	fhuE	Putative ferrichrome-iron receptor
	VAS14_12504	PF11932	hypothetical protein
	VAS14_12499	exbB1	Biopolymer transport protein ExbB-related protein
	VAS14_12494	exbB2	TonB system transport protein ExbB2
	VAS14_12489	exbD2	TonB system transport protein ExbD2
	VAS14_12484	tonB	Periplasmic protein TonB
	VAS14_12479	VC1543	TPR domain protein, putative component of TonB system
Position: -48 Score: 5.6 Sequence: TAATGCAAACTATTATCATTA Locus tag: VAS14_10719 Name: COG2910 Funciton: Putative NADH-flavin reductase
	VAS14_10719	COG2910	Putative NADH-flavin reductase
Position: -141 Score: 5.5 Sequence: AAATGCAAATTATTACCATTA Position: -73 Score: 5.7 Sequence: TAATAATAACAATTATCACTT Locus tag: VAS14_01246 Name: irpA Funciton: Iron-regulated protein A precursor
	VAS14_01246	irpA	Iron-regulated protein A precursor
Position: -128 Score: 6.1 Sequence: AATTGATAATTATTATCAATA Locus tag: VAS14_10544 Name: PF00106 Funciton: Short chain dehydrogenase
	VAS14_10544	PF00106	Short chain dehydrogenase
Position: -190 Score: 5.4 Sequence: AAATGATAATTGATATTATTC Locus tag: VAS14_03958 Name: tonB-hmu Funciton: Periplasmic protein TonB involved in hemin uptake Locus tag: VAS14_03963 Name: exbB-hmu Funciton: TonB system transport protein ExbB involved in hemin uptake Locus tag: VAS14_03968 Name: exbD-hmu Funciton: TonB system transport protein ExbD involved in hemin uptake Locus tag: VAS14_03973 Name: hmuT Funciton: Hemin ABC transporter, periplasmic hemin-binding protein Locus tag: VAS14_03978 Name: hmuU Funciton: Hemin ABC transporter, permease component Locus tag: VAS14_03983 Name: hmuV Funciton: Hemin ABC transporter, ATP-binding subunit
	VAS14_03958	tonB-hmu	Periplasmic protein TonB involved in hemin uptake
	VAS14_03963	exbB-hmu	TonB system transport protein ExbB involved in hemin uptake
	VAS14_03968	exbD-hmu	TonB system transport protein ExbD involved in hemin uptake
	VAS14_03973	hmuT	Hemin ABC transporter, periplasmic hemin-binding protein
	VAS14_03978	hmuU	Hemin ABC transporter, permease component
	VAS14_03983	hmuV	Hemin ABC transporter, ATP-binding subunit
Position: -93 Score: 5.2 Sequence: AATTGATAATAACTCGTATTA Locus tag: VAS14_06553 Name: COG3016 Funciton: Conserved hypothetical iron-regulated protein
	VAS14_06553	COG3016	Conserved hypothetical iron-regulated protein
Position: -62 Score: 5.2 Sequence: AATTACGAATCATTATCGTTT Locus tag: VAS14_22809 Name: VC0074 Funciton: conserved hypothetical protein
	VAS14_22809	VC0074	conserved hypothetical protein
Position: -60 Score: 4.7 Sequence: AAATGAAAACACTTAACAATA Position: -41 Score: 4.8 Sequence: TAATAGGAATCATTATCACTG Locus tag: VAS14_02953 Name: VV1_2646 Funciton: ABC-type multidrug transport system, ATPase and permease component Locus tag: VAS14_02958 Name: pqiA Funciton: Paraquat-inducible protein A Locus tag: VAS14_02963 Name: pqiB Funciton: Paraquat-inducible protein B
	VAS14_02953	VV1_2646	ABC-type multidrug transport system, ATPase and permease component
	VAS14_02958	pqiA	Paraquat-inducible protein A
	VAS14_02963	pqiB	Paraquat-inducible protein B
Position: -80 Score: 5.5 Sequence: AAATGATAGTAATTATCGTTT Locus tag: VAS14_03678 Name: VSAK1_14737 Funciton: TonB-dependent hemin , ferrichrome receptor
	VAS14_03678	VSAK1_14737	TonB-dependent hemin , ferrichrome receptor
Position: -98 Score: 5.6 Sequence: AGATGATAATAATTATCAGTA Position: -92 Score: 4.5 Sequence: TAATAATTATCAGTAGCAATT Position: -44 Score: 5.6 Sequence: CAATGATAATGATTATCAATA Locus tag: VAS14_13589 Name: VC1572 Funciton: hypothetical protein Locus tag: VAS14_13594 Name: fumC Funciton: Fumarate hydratase class II (EC 4.2.1.2)
	VAS14_13589	VC1572	hypothetical protein
	VAS14_13594	fumC	Fumarate hydratase class II (EC 4.2.1.2)
Position: -70 Score: 5.6 Sequence: AAGTGATAATTATTTGCATTA Locus tag: VAS14_15544 Name: fepA Funciton: TonB-dependent ferric achromobactin receptor
	VAS14_15544	fepA	TonB-dependent ferric achromobactin receptor
Position: -29 Score: 5.5 Sequence: AAATAAAAACCATTCTCAATT Locus tag: VAS14_04423 Name: viuB Funciton: Siderophore-interacting protein ViuB
	VAS14_04423	viuB	Siderophore-interacting protein ViuB
Position: -29 Score: 5.5 Sequence: AAATAAAAACCATTCTCAATT Locus tag: VAS14_04423 Name: VIBHAR_06920 Funciton: Siderophore-interacting protein ViuB
	VAS14_04423	VIBHAR_06920	Siderophore-interacting protein ViuB
Position: -82 Score: 5.1 Sequence: AAGTGATAAGCGATATCATTT Locus tag: VAS14_04118 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: VAS14_04123 Name: feoC Funciton: Ferrous iron transport protein C
	VAS14_04118	feoB	Ferrous iron transport protein B
	VAS14_04123	feoC	Ferrous iron transport protein C
Position: -36 Score: 5.8 Sequence: AAATGCTAATAATTCTTATTA Locus tag: VAS14_17796 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: VAS14_17801 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: VAS14_17806 Name: feoC Funciton: Ferrous iron transport protein C
	VAS14_17796	feoA	Ferrous iron transport protein A
	VAS14_17801	feoB	Ferrous iron transport protein B
	VAS14_17806	feoC	Ferrous iron transport protein C
Position: -116 Score: 4.6 Sequence: ATATAGTAATAAGTCTCATTA Position: -53 Score: 5.8 Sequence: TAACGATAATTATTATCATTA Position: -47 Score: 5 Sequence: TAATTATTATCATTATTATTT Locus tag: VAS14_13349 Name: null Funciton: Periplasmic binding protein Locus tag: VAS14_13354 Name: fecD Funciton: Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1) Locus tag: VAS14_13359 Name: fecE Funciton: Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
	VAS14_13349		Periplasmic binding protein
	VAS14_13354	fecD	Iron(III) dicitrate transport system permease protein FecD (TC 3.A.1.14.1)
	VAS14_13359	fecE	Iron(III) dicitrate transport ATP-binding protein FecE (TC 3.A.1.14.1)
Position: -27 Score: 5.6 Sequence: AAATGATAATTCATCTCATTT Locus tag: VAS14_12284 Name: VSAK1_04950 Funciton: TonB-dependent siderophore receptor
	VAS14_12284	VSAK1_04950	TonB-dependent siderophore receptor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Vibrio angustum S14

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --