Orthologous regulated operons containing frdA gene

Properties
Regulog:	Fur - Vibrionales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 447 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio fischeri ES114
Position: -298 Score: 5.25694 Sequence: CAATAAGAATCATTATCACTT Locus tag: VF_2334 Name: frdA Funciton: fumarate reductase, flavoprotein subunit Locus tag: VF_2335 Name: frdB Funciton: fumarate reductase, iron-sulfur protein Locus tag: VF_2336 Name: frdC Funciton: fumarate reductase, 15 kDa hydrophobic protein Locus tag: VF_2337 Name: frdD Funciton: fumarate reductase, 13 kDa hydrophobic protein
frdA-frdB-frdC-frdD	-298	5.3	CAATAAGAATCATTATCACTT	VF_2334
Vibrio salmonicida LFI1238
Position: -256 Score: 4.86504 Sequence: CGATAAGAATCATTATCACTT Locus tag: VSAL_I2788 Name: frdA Funciton: fumarate reductase, flavoprotein subunit Locus tag: VSAL_I2789 Name: frdB Funciton: fumarate reductase, iron-sulfur protein Locus tag: VSAL_I2790 Name: frdC Funciton: fumarate reductase, 15 kDa hydrophobic protein Locus tag: VSAL_I2791 Name: frdD Funciton: fumarate reductase, 13 kDa hydrophobic protein
frdA-frdB-frdC-frdD	-256	4.9	CGATAAGAATCATTATCACTT	VSAL_I2788
Vibrio shilonii AK1
Position: -256 Score: 4.85498 Sequence: AAATCATAATTAAACTCATTA Locus tag: VSAK1_11298 Name: frdA Funciton: fumarate reductase, flavoprotein subunit Locus tag: VSAK1_11293 Name: frdB Funciton: fumarate reductase, iron-sulfur protein Locus tag: VSAK1_11288 Name: frdC Funciton: fumarate reductase, 15 kDa hydrophobic protein Locus tag: VSAK1_11283 Name: frdD Funciton: fumarate reductase, 13 kDa hydrophobic protein
frdA-frdB-frdC-frdD	-256	4.9	AAATCATAATTAAACTCATTA	VSAK1_11298