Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fepC gene

Properties
Regulog: Fur - Vibrionales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 447 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio harveyi ATCC BAA-1116
Position: -95
Score: 4.97582
Sequence: TATTGATATTACTTCTCAGTT
Locus tag: VIBHAR_06007
Name: fepB
Funciton: ABC-type Fe3+-siderophores transport systems, periplasmic component
Locus tag: VIBHAR_06008
Name: fepD
Funciton: ABC-type Fe3+-siderophore transport system, permease component
Locus tag: VIBHAR_06009
Name: fepD
Funciton: ABC-type Fe3+-siderophore transport system, permease component
Locus tag: VIBHAR_06010
Name: fepC
Funciton: ABC-type Fe3+-siderophores transport system, ATPase component
Locus tag: VIBHAR_06011
Name: fepA
Funciton: TonB-dependent ferric achromobactin receptor
fepB-fepD-fepD-fepC-fepA -95 5 TATTGATATTACTTCTCAGTT VIBHAR_06007
© 2009-2020 RegPrecise