Regulog IdeR - Clostridia-3
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-3
- By TF family - DtxR
- By effector - Iron ion, (Fe2+)
- By pathway - Iron homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Blautia hansenii DSM 20583 | 6 | 2 |
| Bacteroides pectinophilus ATCC 43243 | 8 | 3 |
| Bryantella formatexigens DSM 14469 | 13 | 5 |
| Clostridiales bacterium 1_7_47_FAA | 17 | 8 |
| Clostridium bolteae ATCC BAA-613 | 14 | 7 |
| Clostridium nexile DSM 1787 | 15 | 5 |
| Clostridium scindens ATCC 35704 | 10 | 5 |
| Ruminococcus lactaris ATCC 29176 | 12 | 4 |
| Ruminococcus gnavus ATCC 29149 | 14 | 5 |
| Roseburia intestinalis L1-82 | 8 | 4 |
| Eubacterium rectale ATCC 33656 | 9 | 5 |
| Eubacterium eligens ATCC 27750 | 11 | 4 |
| Dorea longicatena DSM 13814 | 12 | 4 |
| Dorea formicigenerans ATCC 27755 | 2 | 1 |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| COG0426 |
|
|
|
*
Clostridiales bacterium 1_7_47_FAA Site: position = -105 score = 4.76479 sequence = TGAGTAAGTGTACACTAAATAA Gene: Cbac1_010100025382: flavodoxin |
*
Clostridium bolteae ATCC BAA-613 Site: position = -107 score = 5.43755 sequence = ATTATTAGTGTACACTAATTTA Gene: CLOBOL_00460: flavodoxin |
|
|
|
|
|
|
|
|
|
flavodoxin |
| CRON 2. | |||||||||||||||
| RUMGNA_02766 |
|
|
|
|
|
|
|
|
*
Ruminococcus gnavus ATCC 29149 Site: position = -93 score = 5.68954 sequence = ATGATTAGAATAAACTAATAAA Site: position = -36 score = 5.37837 sequence = ATAGTTAGCGAAAACTAACTTG Gene: RUMGNA_02766: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| BRYFOR_03360 |
|
|
|
|
|
|
|
|
Gene: RUMGNA_02767: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| PF05031 |
|
|
|
|
|
*
Clostridium nexile DSM 1787 Site: position = -63 score = 5.07371 sequence = CTGGTTAGTTTAATCTAACAAA Gene: CLONEX_02589: Iron transport-associated domain |
|
|
*
Ruminococcus gnavus ATCC 29149 Site: position = -130 score = 4.33286 sequence = ATAAGTAGAATCTTCTAAAACA Gene: RUMGNA_02768: Iron transport-associated domain |
|
|
|
|
|
Iron transport-associated domain |
| PF11545 |
|
|
|
|
|
Gene: CLONEX_02590: Cell surface heme-binding protein Shp |
|
|
Gene: RUMGNA_02769: Cell surface heme-binding protein Shp |
|
|
|
|
|
Cell surface heme-binding protein Shp |
| COG0614 |
|
|
|
|
|
Gene: CLONEX_02591: ABC-type Fe3+-hydroxamate transport system, periplasmic component |
|
|
Gene: RUMGNA_02770: ABC-type Fe3+-hydroxamate transport system, periplasmic component |
|
|
|
|
|
ABC-type Fe3+-hydroxamate transport system, periplasmic component |
| COG0609 |
|
|
|
|
|
Gene: CLONEX_02592: ABC-type Fe3+-siderophore transport system, permease component |
|
|
*
Ruminococcus gnavus ATCC 29149 Site: position = -135 score = 4.29404 sequence = AACGATAAAGTGTACTATCTTA Gene: RUMGNA_02771: ABC-type Fe3+-siderophore transport system, permease component |
|
|
|
|
|
ABC-type Fe3+-siderophore transport system, permease component |
| COG1120 |
|
|
|
|
|
Gene: CLONEX_02593: ABC-type Fe3+-siderophores transport systems, ATPase components |
|
|
Gene: RUMGNA_02772: ABC-type Fe3+-siderophores transport systems, ATPase components |
|
|
|
|
|
ABC-type Fe3+-siderophores transport systems, ATPase components |
| CRON 3. | |||||||||||||||
| COG1132 |
|
|
*
Bryantella formatexigens DSM 14469 Site: position = -52 score = 4.96725 sequence = GGAGTTAGAAAATACTAACCCC Gene: BRYFOR_00595: ABC-type multidrug transport system, ATPase and permease components |
*
Clostridiales bacterium 1_7_47_FAA Site: position = -70 score = 4.47498 sequence = TTCGTTATAATACACTACAGTT Site: position = -54 score = 5.70479 sequence = ACAGTTAGTAAAATCTAACTAT Gene: Cbac1_010100028374: ABC-type multidrug transport system, ATPase and permease components |
|
Gene: CLONEX_00480: ABC-type multidrug transport system, ATPase and permease components |
Gene: CLOSCI_00932: ABC-type multidrug transport system, ATPase and permease components |
|
|
|
|
|
|
*
Dorea formicigenerans ATCC 27755 Site: position = -55 score = 4.76543 sequence = GTGGTTAGATTAAGCTAACCCA Gene: DORFOR_03080: ABC-type multidrug transport system, ATPase and permease components |
ABC-type multidrug transport system, ATPase and permease components |
| COG1132-2 |
|
|
Gene: BRYFOR_00594: ABC-type multidrug transport system, ATPase and permease components |
Gene: Cbac1_010100028379: ABC-type multidrug transport system, ATPase and permease components |
|
Gene: CLONEX_00479: ABC-type multidrug transport system, ATPase and permease components |
Gene: CLOSCI_00931: ABC-type multidrug transport system, ATPase and permease components |
|
|
|
|
|
|
Gene: DORFOR_03079: ABC-type multidrug transport system, ATPase and permease components |
ABC-type multidrug transport system, ATPase and permease components |
| CRON 4. | |||||||||||||||
| ideR |
Gene: BLAHAN_01115: Predicted iron-dependent repressor, DtxR family |
*
Bacteroides pectinophilus ATCC 43243 Site: position = -135 score = 4.52534 sequence = ATGATTAAATTATGCTAAACAA Gene: BACPEC_02631: Predicted iron-dependent repressor, DtxR family |
Gene: BRYFOR_03605: Predicted iron-dependent repressor, DtxR family |
*
Clostridiales bacterium 1_7_47_FAA Site: position = -140 score = 4.54841 sequence = ATGGTTAGTTATTTCTAACTTC Gene: Cbac1_010100022172: Predicted iron-dependent repressor, DtxR family |
*3
Clostridium bolteae ATCC BAA-613 Site: position = -91 score = 4.29257 sequence = CAGATTAGCACTTTCTAACTCT Gene: CLOBOL_01420: Predicted iron-dependent repressor, DtxR family Site: position = -140 score = 5.22125 sequence = ATGTTTAGTGTATGCTATCTTT Gene: CLOBOL_05596: Predicted iron-dependent repressor, DtxR family Site: position = -193 score = 4.41924 sequence = AAAGTTATGGTATCCTAACTGC Gene: CLOBOL_00284: Predicted iron-dependent repressor, DtxR family |
*
Clostridium nexile DSM 1787 Site: position = -139 score = 6.02475 sequence = ATGGTTAGTATACTCTAACGTT Gene: CLONEX_01968: Predicted iron-dependent repressor, DtxR family |
*
Clostridium scindens ATCC 35704 Site: position = -161 score = 5.53778 sequence = GTAGTTAGTATATTCTCATCAT Gene: CLOSCI_00926: Predicted iron-dependent repressor, DtxR family |
*
Ruminococcus lactaris ATCC 29176 Site: position = -139 score = 4.13274 sequence = AATTATAACATAATCTATCAAT Gene: RUMLAC_02635: Predicted iron-dependent repressor, DtxR family |
*
Ruminococcus gnavus ATCC 29149 Site: position = -102 score = 6.10894 sequence = TTAGTTAGTATATTCTAACATT Gene: RUMGNA_03680: Predicted iron-dependent repressor, DtxR family |
Gene: ROSINTL182_00530: Predicted iron-dependent repressor, DtxR family |
*
Eubacterium rectale ATCC 33656 Site: position = -180 score = 5.78984 sequence = ATAGTTAGTATACACTAACGCG Gene: EUBREC_2328: Predicted iron-dependent repressor, DtxR family |
Gene: EUBELI_20503: Predicted iron-dependent repressor, DtxR family |
*
Dorea longicatena DSM 13814 Site: position = -156 score = 6.31362 sequence = ATAGTTAGTATATGCTAACGTT Gene: DORLON_00345: Predicted iron-dependent repressor, DtxR family |
Gene: DORFOR_00462: Predicted iron-dependent repressor, DtxR family |
Predicted iron-dependent repressor, DtxR family |
| PF00881 |
|
|
|
Gene: Cbac1_010100022167: Putative nitroreductase |
Gene: CLOBOL_01421: Putative nitroreductase |
|
|
|
|
|
|
|
|
|
Putative nitroreductase |
| CRON 5. | |||||||||||||||
| BACPEC_02635 |
|
*
Bacteroides pectinophilus ATCC 43243 Site: position = -72 score = 5.93918 sequence = GTAATTAGAATAAACTAACAAT Gene: BACPEC_02635: hypothetical protein |
*
Bryantella formatexigens DSM 14469 Site: position = -82 score = 6.22724 sequence = AATGTTAGCATATACTAACTTC Gene: BRYFOR_03558: hypothetical protein |
*
Clostridiales bacterium 1_7_47_FAA Site: position = -80 score = 4.3138 sequence = GCAGTTAGGATACCATAACTTT Gene: Cbac1_010100004977: hypothetical protein |
*
Clostridium bolteae ATCC BAA-613 Site: position = -81 score = 4.3138 sequence = GCAGTTAGGATACCATAACTTT Gene: CLOBOL_00283: hypothetical protein |
*
Clostridium nexile DSM 1787 Site: position = -65 score = 6.48145 sequence = AACGTTAGAGTATACTAACCAT Gene: CLONEX_01967: hypothetical protein |
Gene: CLOSCI_00838: hypothetical protein |
*
Ruminococcus lactaris ATCC 29176 Site: position = -132 score = 5.99532 sequence = CACGTTAGCGTATACTAACTAA Gene: RUMLAC_01079: hypothetical protein |
Gene: RUMGNA_03678: hypothetical protein |
*
Roseburia intestinalis L1-82 Site: position = -71 score = 6.66813 sequence = AACGTTAGAATATACTAACCAA Gene: ROSINTL182_04350: hypothetical protein |
*
Eubacterium rectale ATCC 33656 Site: position = -130 score = 5.03819 sequence = AAAGTAAGAAAAATCTAAAAAA Site: position = -90 score = 5.41777 sequence = CACGTTAGAGTATACTAACACC Gene: EUBREC_1581: hypothetical protein |
*
Eubacterium eligens ATCC 27750 Site: position = -29 score = 5.78259 sequence = ACCATTAGAATATACTAACCGA Gene: EUBELI_00572: hypothetical protein |
*
Dorea longicatena DSM 13814 Site: position = -120 score = 6.73931 sequence = AACGTTAGCATATACTAACTAT Gene: DORLON_00346: hypothetical protein |
|
hypothetical protein |
| feoA |
|
Gene: BACPEC_02636: Ferrous iron transport protein A |
Gene: BRYFOR_03559: Ferrous iron transport protein A |
Gene: Cbac1_010100004972: Ferrous iron transport protein A |
Gene: CLOBOL_00282: Ferrous iron transport protein A |
Gene: CLONEX_01966: Ferrous iron transport protein A |
Gene: CLOSCI_00837: Ferrous iron transport protein A |
Gene: RUMLAC_01080: Ferrous iron transport protein A |
Gene: RUMGNA_03677: Ferrous iron transport protein A |
Gene: ROSINTL182_04349: Ferrous iron transport protein A |
Gene: EUBREC_1582: Ferrous iron transport protein A |
Gene: EUBELI_00573: Ferrous iron transport protein A |
Gene: DORLON_00347: Ferrous iron transport protein A |
|
Ferrous iron transport protein A |
| feoB |
*
Blautia hansenii DSM 20583 Site: position = -38 score = 4.3916 sequence = TGAGTTAGCATGAACTAATTGA Gene: BLAHAN_00186: Ferrous iron transport protein B |
Gene: BACPEC_02637: Ferrous iron transport protein B |
Gene: BRYFOR_03560: Ferrous iron transport protein B |
Gene: Cbac1_010100004967: Ferrous iron transport protein B |
*2
Clostridium bolteae ATCC BAA-613 Gene: CLOBOL_00281: Ferrous iron transport protein B Site: position = -51 score = 4.96393 sequence = ATAGTTAGCGAAAGCTAATGAA Site: position = -31 score = 4.29449 sequence = AAAATAAGAAAAATATAACAAG Gene: CLOBOL_05594: Ferrous iron transport protein B |
*
Clostridium nexile DSM 1787 Site: position = -58 score = 4.90601 sequence = ATGGTTAGTTAAAACTAATAAA Gene: CLONEX_01965: Ferrous iron transport protein B |
*2
Clostridium scindens ATCC 35704 Site: position = -71 score = 6.14439 sequence = TACGTTAGTATATACTAATTAA Gene: CLOSCI_00924: Ferrous iron transport protein B Gene: CLOSCI_00836: Ferrous iron transport protein B |
Gene: RUMLAC_01081: Ferrous iron transport protein B |
Gene: RUMGNA_03676: Ferrous iron transport protein B |
*
Roseburia intestinalis L1-82 Site: position = -121 score = 4.97382 sequence = GGCGTTAGCAAATGCTAACAAA Gene: ROSINTL182_04347: Ferrous iron transport protein B |
*
Eubacterium rectale ATCC 33656 Site: position = -59 score = 5.39845 sequence = TAGGTTAGTAAATACAAACTAT Gene: EUBREC_1583: Ferrous iron transport protein B |
*
Eubacterium eligens ATCC 27750 Site: position = -89 score = 5.41503 sequence = CAGGTTAGCATAATCTAATTAA Gene: EUBELI_00574: Ferrous iron transport protein B |
Gene: DORLON_00348: Ferrous iron transport protein B |
|
Ferrous iron transport protein B |
| BRYFOR_03561 |
|
|
Gene: BRYFOR_03561: hypothetical protein |
|
|
|
|
Gene: RUMLAC_01082: hypothetical protein |
|
|
|
|
Gene: DORLON_00349: hypothetical protein |
|
hypothetical protein |
| RUMLAC_01083 |
|
|
|
|
|
|
|
Gene: RUMLAC_01083: hypothetical protein |
|
|
|
|
Gene: DORLON_00350: hypothetical protein |
|
hypothetical protein |
| CLOSCI_00923 |
|
|
|
|
|
|
Gene: CLOSCI_00923: hypothetical protein |
|
|
|
|
|
Gene: DORLON_00351: hypothetical protein |
|
hypothetical protein |
| DORLON_00352 |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: DORLON_00352: hypothetical protein |
|
hypothetical protein |
| BACPEC_03058 |
|
Gene: BACPEC_03058: hypothetical protein |
*
Bryantella formatexigens DSM 14469 Site: position = -229 score = 4.72592 sequence = AAAAATAGCGTATACTAGTAAA Site: position = -209 score = 4.97723 sequence = AACGTTAGAGACTTCTAACTGT Gene: BRYFOR_00504: hypothetical protein |
|
Gene: CLOBOL_05591: hypothetical protein |
Gene: CLONEX_01962: hypothetical protein |
*
Clostridium scindens ATCC 35704 Site: position = -171 score = 4.43938 sequence = ACAGTTAGCATTGACTATCTGA Gene: CLOSCI_00921: hypothetical protein |
Gene: RUMLAC_01086: hypothetical protein |
Gene: RUMGNA_03672: hypothetical protein |
Gene: ROSINTL182_02495: hypothetical protein |
*
Eubacterium rectale ATCC 33656 Site: position = -53 score = 4.37003 sequence = CTTGTAAGTAAACTTTAACTAT Gene: EUBREC_1233: hypothetical protein |
Gene: EUBELI_00577: hypothetical protein |
Gene: DORLON_00353: hypothetical protein |
Gene: DORFOR_03340: hypothetical protein |
hypothetical protein |
| COG2217 |
|
Gene: BACPEC_03059: Cation transporting ATPase |
Gene: BRYFOR_00503: Cation transporting ATPase |
Gene: Cbac1_010100004947: Cation transporting ATPase |
2
Clostridium bolteae ATCC BAA-613 Gene: CLOBOL_05590: Cation transporting ATPase Gene: CLOBOL_00279: Cation transporting ATPase |
Gene: CLONEX_01961: Cation transporting ATPase |
Gene: CLOSCI_00920: Cation transporting ATPase |
Gene: RUMLAC_01087: Cation transporting ATPase |
Gene: RUMGNA_03671: Cation transporting ATPase |
Gene: ROSINTL182_02493: Cation transporting ATPase |
Gene: EUBREC_1234: Cation transporting ATPase |
Gene: EUBELI_00578: Cation transporting ATPase |
Gene: DORLON_00354: Cation transporting ATPase |
Gene: DORFOR_03339: Cation transporting ATPase |
Cation transporting ATPase |
| BACPEC_02991 |
|
|
Gene: BRYFOR_03562: hypothetical protein |
Gene: Cbac1_010100004957: heavy metal transport/detoxification protein |
|
|
|
Gene: RUMLAC_01084: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| fur |
|
Gene: BACPEC_02639: Transcriptional regulator for iron transport and metabolism, Fur family |
|
*2
Clostridiales bacterium 1_7_47_FAA Gene: Cbac1_010100004962: Transcriptional regulator for iron transport and metabolism, Fur family Site: position = -216 score = 5.21277 sequence = ATAGTTAGCGTAAACTTACTGA Site: position = -65 score = 4.27907 sequence = ATGGTTAGTCAAAACTATTTCA Gene: Cbac1_010100015165: Transcriptional regulator for iron transport and metabolism, Fur family |
Gene: CLOBOL_05592: Transcriptional regulator for iron transport and metabolism, Fur family |
Gene: CLONEX_01963: Transcriptional regulator for iron transport and metabolism, Fur family |
Gene: CLOSCI_00922: Transcriptional regulator for iron transport and metabolism, Fur family |
Gene: RUMLAC_01085: Transcriptional regulator for iron transport and metabolism, Fur family |
*
Ruminococcus gnavus ATCC 29149 Site: position = -85 score = 6.58007 sequence = AATGTTAGAATATACTAACTAA Gene: RUMGNA_03679: Transcriptional regulator for iron transport and metabolism, Fur family |
Gene: ROSINTL182_04345: Transcriptional regulator for iron transport and metabolism, Fur family |
Gene: EUBREC_1585: Transcriptional regulator for iron transport and metabolism, Fur family |
Gene: EUBELI_00576: Transcriptional regulator for iron transport and metabolism, Fur family |
|
|
Transcriptional regulator for iron transport and metabolism, Fur family |
| Cbac1_010100004952 |
|
|
|
Gene: Cbac1_010100004952: hypothetical protein |
Gene: CLOBOL_00280: hypothetical protein |
|
|
|
|
|
|
|
|
|
hypothetical protein |
| CLONEX_01964 |
|
|
|
|
|
Gene: CLONEX_01964: hypothetical protein |
|
|
|
|
Gene: EUBREC_1584: hypothetical protein |
|
|
|
hypothetical protein |
| BACPEC_02638 |
|
Gene: BACPEC_02638: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| EUBELI_00575 |
|
|
|
|
|
|
|
|
|
|
|
Gene: EUBELI_00575: hypothetical protein |
|
|
hypothetical protein |
| BLAHAN_00185 |
*
Blautia hansenii DSM 20583 Site: position = -67 score = 6.35697 sequence = AAAATTAGTATAAACTAACTTT Gene: BLAHAN_00185: hypothetical protein |
|
|
|
*
Clostridium bolteae ATCC BAA-613 Site: position = -210 score = 4.80816 sequence = GATGTTAGAAAAATATAACTAA Site: position = -104 score = 5.72593 sequence = AAAGATAGCATACACTAAACAT Gene: CLOBOL_05595: hypothetical protein |
|
*
Clostridium scindens ATCC 35704 Site: position = -101 score = 5.80876 sequence = ATGATGAGAATATACTAACTAC Gene: CLOSCI_00925: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| BLAHAN_00187 |
Gene: BLAHAN_00187: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| BLAHAN_00188 |
Gene: BLAHAN_00188: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| ROSINTL182_04346 |
|
|
|
|
|
|
|
|
|
Gene: ROSINTL182_04346: hypothetical protein |
|
|
|
|
hypothetical protein |
| CLOBOL_05593 |
|
|
|
|
Gene: CLOBOL_05593: hypothetical protein |
|
|
|
|
|
|
|
|
|
hypothetical protein |
| CRON 6. | |||||||||||||||
| eno |
Gene: BLAHAN_03002: Enolase (EC 4.2.1.11) |
Gene: BACPEC_02904: Enolase (EC 4.2.1.11) |
*2
Bryantella formatexigens DSM 14469 Site: position = -100 score = 5.56754 sequence = AAAGTTAGTTAAAACTAACTAA Gene: BRYFOR_03081: Enolase (EC 4.2.1.11) Gene: BRYFOR_04620: Enolase (EC 4.2.1.11) |
*2
Clostridiales bacterium 1_7_47_FAA Site: position = -161 score = 5.17996 sequence = TTAGTTAGTAATAACTAACTTT Gene: Cbac1_010100004917: Enolase (EC 4.2.1.11) Gene: Cbac1_010100005852: Enolase (EC 4.2.1.11) |
Gene: CLOBOL_03126: Enolase (EC 4.2.1.11) |
Gene: CLONEX_04118: Enolase (EC 4.2.1.11) |
Gene: CLOSCI_04013: Enolase (EC 4.2.1.11) |
*
Ruminococcus lactaris ATCC 29176 Site: position = -107 score = 5.69582 sequence = ATGGTTAGTTAATACTAACTAT Gene: RUMLAC_01886: Enolase (EC 4.2.1.11) |
*2
Ruminococcus gnavus ATCC 29149 Gene: RUMGNA_00850: Enolase (EC 4.2.1.11) Site: position = -123 score = 4.65431 sequence = AAGGTTAGCGATAACTAACTGA Gene: RUMGNA_03923: Enolase (EC 4.2.1.11) |
*2
Roseburia intestinalis L1-82 Site: position = -55 score = 5.43867 sequence = ATAGTTAGACAAAACTAACAAT Gene: ROSINTL182_03016: Enolase (EC 4.2.1.11) Gene: ROSINTL182_01904: Enolase (EC 4.2.1.11) |
*
Eubacterium rectale ATCC 33656 Site: position = -112 score = 5.37156 sequence = TTAGTTAGATTAAACTAACTGT Gene: EUBREC_2823: Enolase (EC 4.2.1.11) |
*
Eubacterium eligens ATCC 27750 Site: position = -176 score = 4.30484 sequence = AATTTATGTGTATACAAACTAA Site: position = -55 score = 5.85776 sequence = AAAGTTAGAAGAAACTAACTTA Gene: EUBELI_01395: Enolase (EC 4.2.1.11) |
*2
Dorea longicatena DSM 13814 Gene: DORLON_02368: Enolase (EC 4.2.1.11) Site: position = -108 score = 4.35216 sequence = AAAGATATGATATGCTGACGAT Site: position = -88 score = 6.41058 sequence = ATAGTTAGAATAATCTAACTAT Gene: DORLON_00359: Enolase (EC 4.2.1.11) |
Gene: DORFOR_02537: Enolase (EC 4.2.1.11) |
Enolase (EC 4.2.1.11) |
| CRON 7. | |||||||||||||||
| BLAHAN_03142 |
Gene: BLAHAN_03142: hypothetical protein |
|
Gene: BRYFOR_01111: hypothetical protein |
|
|
|
*
Clostridium scindens ATCC 35704 Site: position = -65 score = 4.37098 sequence = ATAGTTAGTCGCAACTAATAAT Gene: CLOSCI_00929: hypothetical protein |
|
|
|
|
Gene: EUBELI_00570: hypothetical protein |
|
|
hypothetical protein |
| COG0716 |
|
Gene: BACPEC_02121: Flavodoxins |
Gene: BRYFOR_01112: Flavodoxins |
Gene: Cbac1_010100027064: Flavodoxins |
Gene: CLOBOL_03815: Flavodoxins |
Gene: CLONEX_01941: Flavodoxins |
Gene: CLOSCI_00928: Flavodoxins |
Gene: RUMLAC_00864: Flavodoxins |
Gene: RUMGNA_03289: Flavodoxins |
*
Roseburia intestinalis L1-82 Site: position = -133 score = 4.49646 sequence = TACAAAAGCATATTCTATCATT Gene: ROSINTL182_04596: Flavodoxins |
|
Gene: EUBELI_00571: Flavodoxins |
Gene: DORLON_00358: Flavodoxins |
Gene: DORFOR_00836: Flavodoxins |
Flavodoxins |
| PF10087 |
*
Blautia hansenii DSM 20583 Site: position = -99 score = 4.83286 sequence = GTAGTTAGTTAAAACTAATCAA Site: position = -38 score = 4.541 sequence = TAAGTTAGATAAGACTAATCAA Gene: BLAHAN_03143: Uncharacterized protein conserved in bacteria |
|
*
Bryantella formatexigens DSM 14469 Site: position = -166 score = 5.74223 sequence = ACAGTTAGCATAAGCTAACTTA Site: position = -99 score = 5.12557 sequence = TAGGTTAGGAAAAACTAACTTA Gene: BRYFOR_01110: Uncharacterized protein conserved in bacteria |
*
Clostridiales bacterium 1_7_47_FAA Site: position = -105 score = 5.77372 sequence = ATAGTTAGTCAATACTAACCAT Gene: Cbac1_010100005502: Uncharacterized protein conserved in bacteria |
|
|
Gene: CLOSCI_00927: Uncharacterized protein conserved in bacteria |
*
Ruminococcus lactaris ATCC 29176 Site: position = -77 score = 5.01337 sequence = TGAGTTAGAAAAGACTAACTAA Gene: RUMLAC_01088: Uncharacterized protein conserved in bacteria |
*
Ruminococcus gnavus ATCC 29149 Site: position = -54 score = 4.65252 sequence = AAGGTTAGTTACAACTAACAAA Gene: RUMGNA_03652: Uncharacterized protein conserved in bacteria |
|
|
*
Eubacterium eligens ATCC 27750 Site: position = -112 score = 4.8897 sequence = ATAGTTAGTTAAAGCTAACTGA Gene: EUBELI_00569: Uncharacterized protein conserved in bacteria |
*
Dorea longicatena DSM 13814 Site: position = -48 score = 4.91131 sequence = TTAGTTAGATAAAGCTAACTAA Gene: DORLON_00403: Uncharacterized protein conserved in bacteria |
Gene: DORFOR_00835: Uncharacterized protein conserved in bacteria |
Uncharacterized protein conserved in bacteria |
| BACPEC_02120 |
|
*
Bacteroides pectinophilus ATCC 43243 Site: position = -44 score = 4.80638 sequence = AAGGTTAGTTATAACTAACTAA Gene: BACPEC_02120: hypothetical protein |
|
*
Clostridiales bacterium 1_7_47_FAA Site: position = -54 score = 5.08201 sequence = TAGGTTAGCTTAAACTAACTGA Gene: Cbac1_010100027059: hypothetical protein |
Gene: CLOBOL_03816: hypothetical protein |
*
Clostridium nexile DSM 1787 Site: position = -32 score = 4.86272 sequence = TAAGTTAGAAATAACTAACTCA Gene: CLONEX_01942: hypothetical protein |
|
|
|
*
Roseburia intestinalis L1-82 Site: position = -89 score = 6.19891 sequence = AAAGTTAGTGTAATCTAACTAT Site: position = -24 score = 5.3978 sequence = GGAGTTAGGATAAACTAACTAT Gene: ROSINTL182_04597: hypothetical protein |
|
|
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |