Regulon of IdeR in Eubacterium rectale ATCC 33656

Properties
Regulator type:	Transcription factor
TF locus tag:	EUBREC_2328
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 4.4 Sequence: CTTGTAAGTAAACTTTAACTAT Locus tag: EUBREC_1233 Name: null Funciton: hypothetical protein Locus tag: EUBREC_1234 Name: COG2217 Funciton: Cation transporting ATPase
	EUBREC_1233		hypothetical protein
	EUBREC_1234	COG2217	Cation transporting ATPase
Position: -59 Score: 5.4 Sequence: TAGGTTAGTAAATACAAACTAT Locus tag: EUBREC_1583 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: EUBREC_1584 Name: null Funciton: hypothetical protein Locus tag: EUBREC_1585 Name: fur Funciton: Transcriptional regulator for iron transport and metabolism, Fur family
	EUBREC_1583	feoB	Ferrous iron transport protein B
	EUBREC_1584		hypothetical protein
	EUBREC_1585	fur	Transcriptional regulator for iron transport and metabolism, Fur family
Position: -130 Score: 5 Sequence: AAAGTAAGAAAAATCTAAAAAA Position: -90 Score: 5.4 Sequence: CACGTTAGAGTATACTAACACC Locus tag: EUBREC_1581 Name: null Funciton: hypothetical protein Locus tag: EUBREC_1582 Name: feoA Funciton: Ferrous iron transport protein A
	EUBREC_1581		hypothetical protein
	EUBREC_1582	feoA	Ferrous iron transport protein A
Position: -180 Score: 5.8 Sequence: ATAGTTAGTATACACTAACGCG Locus tag: EUBREC_2328 Name: ideR Funciton: Predicted iron-dependent repressor, DtxR family
	EUBREC_2328	ideR	Predicted iron-dependent repressor, DtxR family
Position: -112 Score: 5.4 Sequence: TTAGTTAGATTAAACTAACTGT Locus tag: EUBREC_2823 Name: eno Funciton: Enolase (EC 4.2.1.11)
	EUBREC_2823	eno	Enolase (EC 4.2.1.11)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD