Regulon of IdeR in Dorea formicigenerans ATCC 27755

Properties
Regulator type:	Transcription factor
TF locus tag:	DORFOR_00462
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 4.8 Sequence: GTGGTTAGATTAAGCTAACCCA Locus tag: DORFOR_03080 Name: COG1132 Funciton: ABC-type multidrug transport system, ATPase and permease components Locus tag: DORFOR_03079 Name: COG1132-2 Funciton: ABC-type multidrug transport system, ATPase and permease components
	DORFOR_03080	COG1132	ABC-type multidrug transport system, ATPase and permease components
	DORFOR_03079	COG1132-2	ABC-type multidrug transport system, ATPase and permease components

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD