Regulon of IdeR in Bryantella formatexigens DSM 14469

Properties
Regulator type:	Transcription factor
TF locus tag:	BRYFOR_03605
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	13
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5 Sequence: GGAGTTAGAAAATACTAACCCC Locus tag: BRYFOR_00595 Name: COG1132 Funciton: ABC-type multidrug transport system, ATPase and permease components Locus tag: BRYFOR_00594 Name: COG1132-2 Funciton: ABC-type multidrug transport system, ATPase and permease components
	BRYFOR_00595	COG1132	ABC-type multidrug transport system, ATPase and permease components
	BRYFOR_00594	COG1132-2	ABC-type multidrug transport system, ATPase and permease components
Position: -82 Score: 6.2 Sequence: AATGTTAGCATATACTAACTTC Locus tag: BRYFOR_03558 Name: null Funciton: hypothetical protein Locus tag: BRYFOR_03559 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: BRYFOR_03560 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: BRYFOR_03561 Name: null Funciton: hypothetical protein Locus tag: BRYFOR_03562 Name: null Funciton: hypothetical protein
	BRYFOR_03558		hypothetical protein
	BRYFOR_03559	feoA	Ferrous iron transport protein A
	BRYFOR_03560	feoB	Ferrous iron transport protein B
	BRYFOR_03561		hypothetical protein
	BRYFOR_03562		hypothetical protein
Position: -229 Score: 4.7 Sequence: AAAAATAGCGTATACTAGTAAA Position: -209 Score: 5 Sequence: AACGTTAGAGACTTCTAACTGT Locus tag: BRYFOR_00504 Name: null Funciton: hypothetical protein Locus tag: BRYFOR_00503 Name: COG2217 Funciton: Cation transporting ATPase
	BRYFOR_00504		hypothetical protein
	BRYFOR_00503	COG2217	Cation transporting ATPase
Position: -166 Score: 5.7 Sequence: ACAGTTAGCATAAGCTAACTTA Position: -99 Score: 5.1 Sequence: TAGGTTAGGAAAAACTAACTTA Locus tag: BRYFOR_01110 Name: PF10087 Funciton: Uncharacterized protein conserved in bacteria Locus tag: BRYFOR_01111 Name: null Funciton: hypothetical protein Locus tag: BRYFOR_01112 Name: COG0716 Funciton: Flavodoxins
	BRYFOR_01110	PF10087	Uncharacterized protein conserved in bacteria
	BRYFOR_01111		hypothetical protein
	BRYFOR_01112	COG0716	Flavodoxins
Position: -100 Score: 5.6 Sequence: AAAGTTAGTTAAAACTAACTAA Locus tag: BRYFOR_03081 Name: eno Funciton: Enolase (EC 4.2.1.11)
	BRYFOR_03081	eno	Enolase (EC 4.2.1.11)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD