Regulon of IdeR in Ruminococcus gnavus ATCC 29149

Properties
Regulator type:	Transcription factor
TF locus tag:	RUMGNA_03680
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	14
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -135 Score: 4.3 Sequence: AACGATAAAGTGTACTATCTTA Position: -130 Score: 4.3 Sequence: ATAAGTAGAATCTTCTAAAACA Position: -93 Score: 5.7 Sequence: ATGATTAGAATAAACTAATAAA Position: -36 Score: 5.4 Sequence: ATAGTTAGCGAAAACTAACTTG Locus tag: RUMGNA_02766 Name: null Funciton: hypothetical protein Locus tag: RUMGNA_02767 Name: null Funciton: hypothetical protein Locus tag: RUMGNA_02768 Name: PF05031 Funciton: Iron transport-associated domain Locus tag: RUMGNA_02769 Name: PF11545 Funciton: Cell surface heme-binding protein Shp Locus tag: RUMGNA_02770 Name: COG0614 Funciton: ABC-type Fe3+-hydroxamate transport system, periplasmic component Locus tag: RUMGNA_02771 Name: COG0609 Funciton: ABC-type Fe3+-siderophore transport system, permease component Locus tag: RUMGNA_02772 Name: COG1120 Funciton: ABC-type Fe3+-siderophores transport systems, ATPase components
	RUMGNA_02766		hypothetical protein
	RUMGNA_02767		hypothetical protein
	RUMGNA_02768	PF05031	Iron transport-associated domain
	RUMGNA_02769	PF11545	Cell surface heme-binding protein Shp
	RUMGNA_02770	COG0614	ABC-type Fe3+-hydroxamate transport system, periplasmic component
	RUMGNA_02771	COG0609	ABC-type Fe3+-siderophore transport system, permease component
	RUMGNA_02772	COG1120	ABC-type Fe3+-siderophores transport systems, ATPase components
Position: -85 Score: 6.6 Sequence: AATGTTAGAATATACTAACTAA Locus tag: RUMGNA_03679 Name: fur Funciton: Transcriptional regulator for iron transport and metabolism, Fur family Locus tag: RUMGNA_03678 Name: null Funciton: hypothetical protein Locus tag: RUMGNA_03677 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: RUMGNA_03676 Name: feoB Funciton: Ferrous iron transport protein B
	RUMGNA_03679	fur	Transcriptional regulator for iron transport and metabolism, Fur family
	RUMGNA_03678		hypothetical protein
	RUMGNA_03677	feoA	Ferrous iron transport protein A
	RUMGNA_03676	feoB	Ferrous iron transport protein B
Position: -102 Score: 6.1 Sequence: TTAGTTAGTATATTCTAACATT Locus tag: RUMGNA_03680 Name: ideR Funciton: Predicted iron-dependent repressor, DtxR family
	RUMGNA_03680	ideR	Predicted iron-dependent repressor, DtxR family
Position: -123 Score: 4.7 Sequence: AAGGTTAGCGATAACTAACTGA Locus tag: RUMGNA_03923 Name: eno Funciton: Enolase (EC 4.2.1.11)
	RUMGNA_03923	eno	Enolase (EC 4.2.1.11)
Position: -54 Score: 4.7 Sequence: AAGGTTAGTTACAACTAACAAA Locus tag: RUMGNA_03652 Name: PF10087 Funciton: Uncharacterized protein conserved in bacteria
	RUMGNA_03652	PF10087	Uncharacterized protein conserved in bacteria

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD