Regulon of IdeR in Blautia hansenii DSM 20583

Properties
Regulator type:	Transcription factor
TF locus tag:	BLAHAN_01115
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6.4 Sequence: AAAATTAGTATAAACTAACTTT Position: -38 Score: 4.4 Sequence: TGAGTTAGCATGAACTAATTGA Locus tag: BLAHAN_00185 Name: null Funciton: hypothetical protein Locus tag: BLAHAN_00186 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: BLAHAN_00187 Name: null Funciton: hypothetical protein Locus tag: BLAHAN_00188 Name: null Funciton: hypothetical protein
	BLAHAN_00185		hypothetical protein
	BLAHAN_00186	feoB	Ferrous iron transport protein B
	BLAHAN_00187		hypothetical protein
	BLAHAN_00188		hypothetical protein
Position: -99 Score: 4.8 Sequence: GTAGTTAGTTAAAACTAATCAA Position: -38 Score: 4.5 Sequence: TAAGTTAGATAAGACTAATCAA Locus tag: BLAHAN_03143 Name: PF10087 Funciton: Uncharacterized protein conserved in bacteria Locus tag: BLAHAN_03142 Name: null Funciton: hypothetical protein
	BLAHAN_03143	PF10087	Uncharacterized protein conserved in bacteria
	BLAHAN_03142		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD