Regulon of IdeR in Bacteroides pectinophilus ATCC 43243

Properties
Regulator type:	Transcription factor
TF locus tag:	BACPEC_02631
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5.9 Sequence: GTAATTAGAATAAACTAACAAT Locus tag: BACPEC_02635 Name: null Funciton: hypothetical protein Locus tag: BACPEC_02636 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: BACPEC_02637 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: BACPEC_02638 Name: null Funciton: hypothetical protein Locus tag: BACPEC_02639 Name: fur Funciton: Transcriptional regulator for iron transport and metabolism, Fur family
	BACPEC_02635		hypothetical protein
	BACPEC_02636	feoA	Ferrous iron transport protein A
	BACPEC_02637	feoB	Ferrous iron transport protein B
	BACPEC_02638		hypothetical protein
	BACPEC_02639	fur	Transcriptional regulator for iron transport and metabolism, Fur family
Position: -44 Score: 4.8 Sequence: AAGGTTAGTTATAACTAACTAA Locus tag: BACPEC_02120 Name: null Funciton: hypothetical protein Locus tag: BACPEC_02121 Name: COG0716 Funciton: Flavodoxins
	BACPEC_02120		hypothetical protein
	BACPEC_02121	COG0716	Flavodoxins
Position: -135 Score: 4.5 Sequence: ATGATTAAATTATGCTAAACAA Locus tag: BACPEC_02631 Name: ideR Funciton: Predicted iron-dependent repressor, DtxR family
	BACPEC_02631	ideR	Predicted iron-dependent repressor, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD