Regulon of IdeR in Ruminococcus lactaris ATCC 29176

Properties
Regulator type:	Transcription factor
TF locus tag:	RUMLAC_02635
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	IdeR - Clostridia-3
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - DtxR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -132 Score: 6 Sequence: CACGTTAGCGTATACTAACTAA Locus tag: RUMLAC_01079 Name: null Funciton: hypothetical protein Locus tag: RUMLAC_01080 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: RUMLAC_01081 Name: feoB Funciton: Ferrous iron transport protein B Locus tag: RUMLAC_01082 Name: null Funciton: hypothetical protein Locus tag: RUMLAC_01083 Name: null Funciton: hypothetical protein Locus tag: RUMLAC_01084 Name: null Funciton: hypothetical protein Locus tag: RUMLAC_01085 Name: fur Funciton: Transcriptional regulator for iron transport and metabolism, Fur family Locus tag: RUMLAC_01086 Name: null Funciton: hypothetical protein Locus tag: RUMLAC_01087 Name: COG2217 Funciton: Cation transporting ATPase
	RUMLAC_01079		hypothetical protein
	RUMLAC_01080	feoA	Ferrous iron transport protein A
	RUMLAC_01081	feoB	Ferrous iron transport protein B
	RUMLAC_01082		hypothetical protein
	RUMLAC_01083		hypothetical protein
	RUMLAC_01084		hypothetical protein
	RUMLAC_01085	fur	Transcriptional regulator for iron transport and metabolism, Fur family
	RUMLAC_01086		hypothetical protein
	RUMLAC_01087	COG2217	Cation transporting ATPase
Position: -139 Score: 4.1 Sequence: AATTATAACATAATCTATCAAT Locus tag: RUMLAC_02635 Name: ideR Funciton: Predicted iron-dependent repressor, DtxR family
	RUMLAC_02635	ideR	Predicted iron-dependent repressor, DtxR family
Position: -107 Score: 5.7 Sequence: ATGGTTAGTTAATACTAACTAT Locus tag: RUMLAC_01886 Name: eno Funciton: Enolase (EC 4.2.1.11)
	RUMLAC_01886	eno	Enolase (EC 4.2.1.11)
Position: -77 Score: 5 Sequence: TGAGTTAGAAAAGACTAACTAA Locus tag: RUMLAC_01088 Name: PF10087 Funciton: Uncharacterized protein conserved in bacteria
	RUMLAC_01088	PF10087	Uncharacterized protein conserved in bacteria

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD